ID: 924342602

View in Genome Browser
Species Human (GRCh38)
Location 1:243050982-243051004
Sequence TTCCCAGCACATGGCCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924342593_924342602 16 Left 924342593 1:243050943-243050965 CCCGTGGGCAGCCCTGCTGCTGC No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342598_924342602 -7 Left 924342598 1:243050966-243050988 CCACCTGAGCTGCTCATTCCCAG No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342596_924342602 4 Left 924342596 1:243050955-243050977 CCTGCTGCTGCCCACCTGAGCTG No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342599_924342602 -10 Left 924342599 1:243050969-243050991 CCTGAGCTGCTCATTCCCAGCAC No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342597_924342602 -6 Left 924342597 1:243050965-243050987 CCCACCTGAGCTGCTCATTCCCA No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342595_924342602 5 Left 924342595 1:243050954-243050976 CCCTGCTGCTGCCCACCTGAGCT No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data
924342594_924342602 15 Left 924342594 1:243050944-243050966 CCGTGGGCAGCCCTGCTGCTGCC No data
Right 924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924342602 Original CRISPR TTCCCAGCACATGGCCGGTG AGG Intergenic
No off target data available for this crispr