ID: 924345335

View in Genome Browser
Species Human (GRCh38)
Location 1:243068320-243068342
Sequence GTGTGCACCACCACCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345335_924345340 5 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345340 1:243068348-243068370 GTTCCAGCTACTTGGGAGTCTGG No data
924345335_924345342 7 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345342 1:243068350-243068372 TCCAGCTACTTGGGAGTCTGGGG 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
924345335_924345345 11 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345345 1:243068354-243068376 GCTACTTGGGAGTCTGGGGTGGG 0: 31
1: 494
2: 16352
3: 113220
4: 215481
924345335_924345341 6 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345341 1:243068349-243068371 TTCCAGCTACTTGGGAGTCTGGG No data
924345335_924345336 -3 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345336 1:243068340-243068362 CACCCGTAGTTCCAGCTACTTGG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
924345335_924345337 -2 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345337 1:243068341-243068363 ACCCGTAGTTCCAGCTACTTGGG 0: 25
1: 987
2: 20064
3: 110438
4: 252345
924345335_924345344 10 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345344 1:243068353-243068375 AGCTACTTGGGAGTCTGGGGTGG 0: 33
1: 496
2: 14727
3: 30337
4: 46849
924345335_924345346 30 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345346 1:243068373-243068395 TGGGAGAAATCCCTTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345335 Original CRISPR GTGTGCACCACCACCACACC TGG (reversed) Intergenic
No off target data available for this crispr