ID: 924345336

View in Genome Browser
Species Human (GRCh38)
Location 1:243068340-243068362
Sequence CACCCGTAGTTCCAGCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279565
Summary {0: 29, 1: 1597, 2: 33463, 3: 109179, 4: 135297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345330_924345336 16 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345336 1:243068340-243068362 CACCCGTAGTTCCAGCTACTTGG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
924345335_924345336 -3 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345336 1:243068340-243068362 CACCCGTAGTTCCAGCTACTTGG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345336 Original CRISPR CACCCGTAGTTCCAGCTACT TGG Intergenic
Too many off-targets to display for this crispr