ID: 924345337

View in Genome Browser
Species Human (GRCh38)
Location 1:243068341-243068363
Sequence ACCCGTAGTTCCAGCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383859
Summary {0: 25, 1: 987, 2: 20064, 3: 110438, 4: 252345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345335_924345337 -2 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345337 1:243068341-243068363 ACCCGTAGTTCCAGCTACTTGGG 0: 25
1: 987
2: 20064
3: 110438
4: 252345
924345330_924345337 17 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345337 1:243068341-243068363 ACCCGTAGTTCCAGCTACTTGGG 0: 25
1: 987
2: 20064
3: 110438
4: 252345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345337 Original CRISPR ACCCGTAGTTCCAGCTACTT GGG Intergenic
Too many off-targets to display for this crispr