ID: 924345340

View in Genome Browser
Species Human (GRCh38)
Location 1:243068348-243068370
Sequence GTTCCAGCTACTTGGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345330_924345340 24 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345340 1:243068348-243068370 GTTCCAGCTACTTGGGAGTCTGG No data
924345335_924345340 5 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345340 1:243068348-243068370 GTTCCAGCTACTTGGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345340 Original CRISPR GTTCCAGCTACTTGGGAGTC TGG Intergenic
No off target data available for this crispr