ID: 924345341

View in Genome Browser
Species Human (GRCh38)
Location 1:243068349-243068371
Sequence TTCCAGCTACTTGGGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345335_924345341 6 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345341 1:243068349-243068371 TTCCAGCTACTTGGGAGTCTGGG No data
924345330_924345341 25 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345341 1:243068349-243068371 TTCCAGCTACTTGGGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345341 Original CRISPR TTCCAGCTACTTGGGAGTCT GGG Intergenic
No off target data available for this crispr