ID: 924345342

View in Genome Browser
Species Human (GRCh38)
Location 1:243068350-243068372
Sequence TCCAGCTACTTGGGAGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590101
Summary {0: 85, 1: 6786, 2: 109153, 3: 219239, 4: 254838}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345330_924345342 26 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345342 1:243068350-243068372 TCCAGCTACTTGGGAGTCTGGGG 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
924345335_924345342 7 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345342 1:243068350-243068372 TCCAGCTACTTGGGAGTCTGGGG 0: 85
1: 6786
2: 109153
3: 219239
4: 254838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345342 Original CRISPR TCCAGCTACTTGGGAGTCTG GGG Intergenic
Too many off-targets to display for this crispr