ID: 924345344

View in Genome Browser
Species Human (GRCh38)
Location 1:243068353-243068375
Sequence AGCTACTTGGGAGTCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92442
Summary {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345335_924345344 10 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345344 1:243068353-243068375 AGCTACTTGGGAGTCTGGGGTGG 0: 33
1: 496
2: 14727
3: 30337
4: 46849
924345330_924345344 29 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345344 1:243068353-243068375 AGCTACTTGGGAGTCTGGGGTGG 0: 33
1: 496
2: 14727
3: 30337
4: 46849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345344 Original CRISPR AGCTACTTGGGAGTCTGGGG TGG Intergenic
Too many off-targets to display for this crispr