ID: 924345345

View in Genome Browser
Species Human (GRCh38)
Location 1:243068354-243068376
Sequence GCTACTTGGGAGTCTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345578
Summary {0: 31, 1: 494, 2: 16352, 3: 113220, 4: 215481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924345330_924345345 30 Left 924345330 1:243068301-243068323 CCAAAAAAAGAAACATTAGCCAG No data
Right 924345345 1:243068354-243068376 GCTACTTGGGAGTCTGGGGTGGG 0: 31
1: 494
2: 16352
3: 113220
4: 215481
924345335_924345345 11 Left 924345335 1:243068320-243068342 CCAGGTGTGGTGGTGGTGCACAC No data
Right 924345345 1:243068354-243068376 GCTACTTGGGAGTCTGGGGTGGG 0: 31
1: 494
2: 16352
3: 113220
4: 215481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924345345 Original CRISPR GCTACTTGGGAGTCTGGGGT GGG Intergenic
Too many off-targets to display for this crispr