ID: 924350697

View in Genome Browser
Species Human (GRCh38)
Location 1:243112107-243112129
Sequence TATGTGTTGTAACCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924350696_924350697 13 Left 924350696 1:243112071-243112093 CCAAGCACAAAAAGACAAATACT No data
Right 924350697 1:243112107-243112129 TATGTGTTGTAACCAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924350697 Original CRISPR TATGTGTTGTAACCAAACCC AGG Intergenic
No off target data available for this crispr