ID: 924353720

View in Genome Browser
Species Human (GRCh38)
Location 1:243146987-243147009
Sequence CCATCTAGAGGCACTCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 7, 3: 7, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924353708_924353720 11 Left 924353708 1:243146953-243146975 CCCCCCTAACCAGTAAAGACCAA 0: 3
1: 0
2: 0
3: 9
4: 125
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353711_924353720 8 Left 924353711 1:243146956-243146978 CCCTAACCAGTAAAGACCAATTG 0: 4
1: 1
2: 0
3: 11
4: 66
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353714_924353720 -8 Left 924353714 1:243146972-243146994 CCAATTGTGAATCCCCCATCTAG 0: 1
1: 1
2: 0
3: 8
4: 69
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353713_924353720 2 Left 924353713 1:243146962-243146984 CCAGTAAAGACCAATTGTGAATC No data
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353712_924353720 7 Left 924353712 1:243146957-243146979 CCTAACCAGTAAAGACCAATTGT 0: 4
1: 1
2: 2
3: 17
4: 96
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353709_924353720 10 Left 924353709 1:243146954-243146976 CCCCCTAACCAGTAAAGACCAAT 0: 3
1: 0
2: 0
3: 6
4: 89
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353707_924353720 23 Left 924353707 1:243146941-243146963 CCAATTGTGAATCCCCCCTAACC 0: 3
1: 0
2: 1
3: 4
4: 56
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123
924353710_924353720 9 Left 924353710 1:243146955-243146977 CCCCTAACCAGTAAAGACCAATT 0: 3
1: 0
2: 0
3: 4
4: 102
Right 924353720 1:243146987-243147009 CCATCTAGAGGCACTCCAGATGG 0: 1
1: 1
2: 7
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924353720 Original CRISPR CCATCTAGAGGCACTCCAGA TGG Intronic