ID: 924355803

View in Genome Browser
Species Human (GRCh38)
Location 1:243174204-243174226
Sequence AATCTATTCTGTGACATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924355803_924355806 -9 Left 924355803 1:243174204-243174226 CCCTGGATGTCACAGAATAGATT 0: 2
1: 0
2: 1
3: 19
4: 162
Right 924355806 1:243174218-243174240 GAATAGATTGGAAAAATTTTAGG 0: 2
1: 1
2: 19
3: 114
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924355803 Original CRISPR AATCTATTCTGTGACATCCA GGG (reversed) Intronic
904842711 1:33383711-33383733 AATATATTCTGTGTCTTCTATGG + Intronic
905191244 1:36236665-36236687 AAACTCTTCTGTGAAATCTAAGG - Intronic
906235512 1:44205700-44205722 AATCTATTCTCTGCAAGCCAAGG - Intergenic
907818409 1:57942746-57942768 GCTCTGTTCTGTGCCATCCAGGG - Intronic
908013747 1:59810404-59810426 TATCCATTCTGAGACATTCAGGG + Intergenic
910076215 1:83282251-83282273 AACCTATTTTGTCACATTCATGG - Intergenic
910160703 1:84269493-84269515 AATCTACTCAGTCACACCCAGGG - Intergenic
911430200 1:97775213-97775235 AATATATTCTTAGACATTCAGGG - Intronic
915709224 1:157878331-157878353 GATCAAGTCTGTGCCATCCATGG + Intronic
916767731 1:167877919-167877941 AATCTTTGCAGTGACATACAAGG - Intronic
917474777 1:175359726-175359748 AATCTATTCTGTTTCAGCCATGG - Exonic
918440092 1:184558262-184558284 TTTATATTCTGTGACATACATGG - Intronic
918461589 1:184782530-184782552 AATCTACTCTGTGTCTACCAAGG - Intergenic
919505423 1:198392140-198392162 ACTCTACTTTGTGACACCCAGGG + Intergenic
921185782 1:212668077-212668099 AAGCTCTTCCGAGACATCCAAGG - Intergenic
921640859 1:217551929-217551951 AATATTTTCTGTGGCATCCAAGG - Intronic
923565065 1:235070309-235070331 AATGCATTCTGTGCCATGCAGGG - Intergenic
924355803 1:243174204-243174226 AATCTATTCTGTGACATCCAGGG - Intronic
1065185861 10:23170890-23170912 AATCTATTCTGAGATCTCTAGGG - Intergenic
1065530189 10:26661558-26661580 ATTCGATGCTTTGACATCCAGGG - Intergenic
1067171439 10:43910175-43910197 ACTCCATTCTGTGACAAGCAGGG - Intergenic
1068393397 10:56428136-56428158 AATCTATTCTGTGATGTAAAAGG - Intergenic
1069142707 10:64847230-64847252 AATATTTTCTGTGTCATCAATGG - Intergenic
1072227649 10:93385101-93385123 AATACATTCGGTCACATCCAAGG + Intronic
1080303478 11:30811431-30811453 CATCTAGACTGTGACATCCATGG - Intergenic
1080465690 11:32495173-32495195 AATATAAACTGTGGCATCCAGGG + Intergenic
1084017704 11:66395808-66395830 AGTCTTTTCTGTGAAATCTAGGG - Intergenic
1085150720 11:74251065-74251087 CTTGTCTTCTGTGACATCCAGGG - Intronic
1086536461 11:87852843-87852865 AAACAATTCTGAGACACCCATGG - Intergenic
1087194035 11:95286594-95286616 AATCTATTCTCTGCCAAACAAGG - Intergenic
1087328781 11:96754031-96754053 ATTCTTCTCTGTGACAGCCACGG + Intergenic
1088057438 11:105602425-105602447 AATATATTCAGTCACAGCCAAGG + Intergenic
1089845685 11:121456194-121456216 ATTCCATTCTTTAACATCCAAGG + Intronic
1091069534 11:132550195-132550217 AATGTAATCTGTGACATTAAGGG + Intronic
1091358475 11:134956277-134956299 AATGCATTCTGTGCCCTCCATGG - Intergenic
1092647856 12:10598087-10598109 AATCTATTCTGTGACTCTGAAGG + Intergenic
1093203043 12:16212801-16212823 AATTGATTCTGTGTCATCCAGGG - Intronic
1099020357 12:77395995-77396017 AATCTTTTCTGTAAGAGCCATGG - Intergenic
1100979302 12:100152299-100152321 AATCTATTCTGAGCAGTCCATGG - Intergenic
1104092207 12:125526477-125526499 AATCTTACCTGTGACAGCCATGG + Intronic
1104265647 12:127230312-127230334 AAAGGATTCTGTGTCATCCAGGG + Intergenic
1104469626 12:129019051-129019073 TATATAGTGTGTGACATCCAGGG + Intergenic
1104591367 12:130086671-130086693 TAGCTAAACTGTGACATCCAGGG - Intergenic
1105937477 13:25115591-25115613 AATCCTTTCTGTGTCATCCAAGG - Intergenic
1107392055 13:39976136-39976158 AATCTATGCTGTAACCTCAAGGG + Intergenic
1109105657 13:58247004-58247026 AATTTCTTCTTTCACATCCAGGG + Intergenic
1109213953 13:59566173-59566195 TAGATATTCTGTGGCATCCAAGG - Intergenic
1109942524 13:69389759-69389781 AATGTATTCTGTGAACTCCATGG + Intergenic
1113143606 13:107182946-107182968 AGTCTATTTTATGAAATCCAAGG + Intronic
1118621903 14:67621021-67621043 AGTCTTTTCTCTGACATCCAGGG + Intronic
1119043966 14:71301170-71301192 AATCTATTATGTGTCATAAATGG + Intergenic
1123947649 15:25246558-25246580 AATCCATTGTGTCACCTCCAGGG + Intergenic
1124012351 15:25849058-25849080 AGTCTTTTCTGTGCCTTCCATGG + Intronic
1125110000 15:36021567-36021589 AATAAATGCTGTGACAACCAAGG + Intergenic
1125253670 15:37736895-37736917 ATTCTATTCTGTAACATCACAGG - Intergenic
1125848418 15:42880743-42880765 AATTTATTGTGTGATATACAAGG - Intronic
1127259445 15:57317548-57317570 AATCTACTCTGTGCCAGGCAGGG + Intergenic
1127864334 15:63019652-63019674 GCTGTATTCTGTGTCATCCATGG - Intergenic
1128085807 15:64885950-64885972 ATTCAACTCTGTGACATCCCTGG + Intronic
1128413478 15:67422201-67422223 AAACTATTTTATGCCATCCAGGG + Intronic
1129494587 15:75966173-75966195 ATTCGATTCTGTGGCATTCAAGG + Intronic
1132436029 15:101803335-101803357 AATTCATTCTGTGCCATCCACGG - Intergenic
1134113388 16:11530316-11530338 CATCTATTCTTTGAGATCCAGGG - Intergenic
1134870010 16:17644108-17644130 AATCTATTATGTGACAAGCTGGG - Intergenic
1135833801 16:25804695-25804717 AAGCTAGTATATGACATCCAAGG - Intronic
1136912663 16:34157422-34157444 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1139774006 16:69302352-69302374 TACCTATTCTTTGAGATCCAGGG - Exonic
1142895734 17:2977381-2977403 AAACTAGTCTGTGACATCTCTGG - Intronic
1144752872 17:17662085-17662107 ATTCTATTATGTGACATTCCGGG - Intergenic
1145051709 17:19667191-19667213 ACACTATTCTGTCACATACAGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1154496473 18:14964941-14964963 AATGCATTCTGTGCCCTCCATGG + Intergenic
1156073540 18:33243742-33243764 AATGTAGTTTGTGACAGCCACGG + Intronic
1158533705 18:58287420-58287442 ATTCTACTCTGTGATCTCCATGG - Intronic
1159538017 18:69739345-69739367 AATCTACTCTCTGACATCCAAGG - Intronic
1165638601 19:37364759-37364781 AATAGTTTCTGTAACATCCAGGG - Intronic
1165871712 19:38977327-38977349 GCTCAATTCTCTGACATCCAGGG + Intergenic
1167821634 19:51933631-51933653 AGTCTATTCTGTTCCCTCCAGGG + Intronic
929490304 2:42390374-42390396 GATCTATTCTGAGCCATCCTGGG + Intronic
933196164 2:79392423-79392445 AATGTTTTCTCTGAAATCCATGG + Intronic
935343033 2:102075112-102075134 AATCAGTTATGTGACATCCATGG + Intronic
937123197 2:119454931-119454953 AATCTATTCTGTTCAACCCAAGG - Intronic
939391065 2:141570466-141570488 AAAATAATCTGTGCCATCCAAGG - Intronic
939474522 2:142669876-142669898 AATGTAGTCAGTGACAACCAAGG - Intergenic
939676155 2:145074326-145074348 AATATATCCTGTGAGACCCAGGG + Intergenic
940494956 2:154415905-154415927 AATTTACTCTGTGAAATCCCTGG - Intronic
941483686 2:166051295-166051317 AATCTATTATTTAAAATCCAGGG + Intronic
945177203 2:207054775-207054797 CATCTATTCTGAAACATCCTTGG + Intergenic
945502473 2:210593109-210593131 AATTTCCTCTGTGACATTCATGG - Intronic
948399284 2:237671400-237671422 CATCTATTCTGTGCCTTCCTGGG - Intronic
1170271462 20:14531532-14531554 AATTTATTCTGTCACATCTCTGG - Intronic
1170292639 20:14787857-14787879 AGTCTATTCTGTGGCATTCTTGG + Intronic
1170939505 20:20836760-20836782 AATCTATTCTGAGACAAACAGGG - Intergenic
1173029857 20:39345607-39345629 CATATATTCTCTGACAGCCATGG + Intergenic
1176210059 20:63915293-63915315 AATATATTCTGTGACCTCAAAGG + Intronic
1176553195 21:8238978-8239000 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176572117 21:8422002-8422024 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176580026 21:8466585-8466607 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176589080 21:8623072-8623094 ATTTTATTCTGAGACATCAAGGG - Intergenic
1177201459 21:17961468-17961490 AATCTTTTCAGAGGCATCCAGGG + Intronic
1177366507 21:20146171-20146193 AATTTATTTACTGACATCCATGG - Intergenic
1178455242 21:32743477-32743499 AATTTATTCTGAGACACTCAGGG + Intronic
1180271906 22:10600069-10600091 ATTTTATTCTGAGACATCAAGGG - Intergenic
1181665312 22:24391495-24391517 GATCTAATTTGTGTCATCCAGGG - Intronic
1203258193 22_KI270733v1_random:156020-156042 AATCTATTTTGTGGCCTCAAGGG - Intergenic
949138236 3:598697-598719 ATTTTATTCTGAGACATCAAGGG + Intergenic
950467666 3:13164871-13164893 AATCCAATTTGGGACATCCAGGG - Intergenic
950795760 3:15509728-15509750 AATTGATTCTATGATATCCAAGG + Intronic
952646073 3:35660518-35660540 AATCTCTTCTGTGCCATCCTTGG + Intronic
953975208 3:47377093-47377115 AAAGTATTCTGTGAGTTCCAGGG - Intergenic
954841065 3:53512314-53512336 AATCTTTTCCTAGACATCCATGG + Intronic
957954468 3:87166887-87166909 AATCTATACTTAGATATCCATGG + Intergenic
959414120 3:106062448-106062470 TATCTCTTGTGTGAGATCCAGGG + Intergenic
965845282 3:172953893-172953915 AATATATTCTGTCTCATCCCAGG - Intronic
969844566 4:9910258-9910280 AACCTTTGCTGTCACATCCATGG + Intronic
969966262 4:10999914-10999936 GATCTATTCTGTGTCTTACATGG + Intergenic
971850978 4:31986218-31986240 AAGGTTTTCTGTGACATGCATGG + Intergenic
972952916 4:44350964-44350986 AATCTACCCTGAGACATCCCAGG - Intronic
973564881 4:52174706-52174728 AATCTATTCTGTCACAACTCTGG + Intergenic
975383635 4:73730501-73730523 AATCTATTCAATGACATCTGTGG - Intergenic
976104362 4:81601047-81601069 AACACATTCTGTGACATCCAGGG + Intronic
978949825 4:114544788-114544810 AATCTGCTCTGTAACAGCCATGG + Intergenic
979246009 4:118505427-118505449 AATCTATTCTGTGACATCCAGGG + Intergenic
979460080 4:120972104-120972126 AATAAATTCTGTGACTTTCAAGG - Intergenic
982372745 4:154651858-154651880 AATCTATCCTGTGAACTCCCTGG + Intronic
984214567 4:176893797-176893819 AATCTATACTGTGAAATGTATGG - Intergenic
984570122 4:181382095-181382117 AATGTATTATGTGAAATACATGG + Intergenic
984714268 4:182912192-182912214 AAACATTTCTGTGACATCCCAGG + Intronic
986051835 5:4097368-4097390 CATTTATCCTGTGACATCCCTGG - Intergenic
988202693 5:28088191-28088213 AATATATTCAGAGACATACATGG + Intergenic
988427718 5:31082944-31082966 AATCTCTTCTGTGGCTTCCAAGG - Intergenic
989298110 5:39853610-39853632 GATTTATTCTTTTACATCCAAGG - Intergenic
990724081 5:58734124-58734146 ATTCATTTCTGTGACATTCAGGG + Intronic
993015204 5:82527621-82527643 ATTTAATTCTGTGCCATCCAAGG - Intergenic
993336339 5:86664248-86664270 AATCAATTTTCTGACTTCCAAGG + Intergenic
994156902 5:96513982-96514004 AAAGTATTCTGTGACAGCCAAGG - Intergenic
995274038 5:110258090-110258112 AATCTTTTCAGTAACAGCCACGG + Intergenic
995503311 5:112832528-112832550 AATGTTTGCTGTGACATTCAAGG + Intronic
995911843 5:117197038-117197060 TATTTATTCTGTGACATTCCTGG - Intergenic
996278933 5:121703859-121703881 AATATATTTTGAGACATCTAAGG - Intergenic
997933759 5:138093164-138093186 TATCTATTCTCTGACATCTGTGG - Intergenic
999904117 5:156120604-156120626 AATCCATTCTAAGTCATCCAAGG - Intronic
1003966621 6:11258044-11258066 ACTCTATTCTGTTACAGCCATGG + Intronic
1006065312 6:31457160-31457182 AATCTATTCTGTTAGCTTCATGG + Intergenic
1008993603 6:57632970-57632992 AATCTATTCTGTGCCAGACTGGG - Intronic
1009182209 6:60532056-60532078 AATCTATTCTGTGCCAGACTGGG - Intergenic
1010205164 6:73315750-73315772 AATCTATTCTGTTCCCTCAATGG + Intergenic
1010358915 6:74969563-74969585 AAACTTTTCTGTGATTTCCAAGG + Intergenic
1010406123 6:75507888-75507910 AATCCATTCTGGGACATGGATGG + Intergenic
1010577585 6:77551428-77551450 AATCTATTCTGTTCAATACAGGG - Intergenic
1014050782 6:116951966-116951988 TACATATTCTGTCACATCCATGG + Intergenic
1014972372 6:127833485-127833507 AATCTGAGCTTTGACATCCAAGG + Intronic
1015816441 6:137216470-137216492 AATGTATTGTGTTACATTCATGG - Intronic
1018437952 6:163780191-163780213 AATCTTTTCTGTTGCATGCATGG + Intergenic
1021078068 7:16329398-16329420 AATATATTTTGTGGCTTCCAGGG - Intronic
1027293989 7:76747428-76747450 AACCTATTTTGTCACATACATGG - Intergenic
1028753850 7:94412492-94412514 AAACTATTCTGTTTCATCCGTGG + Intronic
1030334765 7:108313384-108313406 AACCAATTCAGTGACACCCAAGG + Intronic
1031691238 7:124790546-124790568 AATCTACTCTTTGACAAACATGG - Exonic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1034935155 7:155194552-155194574 AATCCACTCTGTGCCATCCAGGG + Intergenic
1038147222 8:24909480-24909502 AATCCTTTCTGTGAAAGCCAGGG - Intergenic
1043161269 8:76850982-76851004 ATTCCATTCTGAGACTTCCAAGG - Exonic
1043525621 8:81093837-81093859 AATCTACACTGTGACAATCATGG + Intronic
1043741904 8:83824772-83824794 TATAGAATCTGTGACATCCATGG + Intergenic
1044330369 8:90913027-90913049 AATCAAGTCAGTGACATCTAGGG - Intronic
1045600175 8:103706157-103706179 ATTCTTTTCTTTGAAATCCACGG - Intronic
1046462584 8:114560436-114560458 AAACTCTTGTGTGGCATCCAAGG + Intergenic
1050089235 9:2000238-2000260 AATCTATTCTCTGCCACCCCTGG + Intergenic
1051090233 9:13398583-13398605 AATCTATTCTGTGATATTAGGGG + Intergenic
1051167041 9:14273960-14273982 AATCTATTATATGACATCAGAGG - Intronic
1053306752 9:36989803-36989825 CATGGCTTCTGTGACATCCATGG + Intronic
1053967289 9:43667909-43667931 ATTCTACTCTGTGACTTCAATGG - Intergenic
1054021973 9:44615714-44615736 ATTCTACTCTGTGACTTCAATGG - Intergenic
1058890025 9:109353693-109353715 AATCTATACTGTGCCAGGCATGG - Intergenic
1059785636 9:117579809-117579831 GATCTGTTCTGAGAAATCCATGG - Intergenic
1203474387 Un_GL000220v1:138043-138065 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1203619085 Un_KI270749v1:101652-101674 ATTTTATTCTGAGACATCAAGGG - Intergenic
1186987696 X:15034531-15034553 AACCTACTCTGTAATATCCAGGG - Intergenic
1187366233 X:18667659-18667681 ACTCTCTTCAGTGACATACATGG - Intronic
1192389395 X:70709848-70709870 TATCTCTTATGTGACTTCCAAGG + Intronic
1193703994 X:84798148-84798170 AATATATTCTGAAATATCCAGGG - Intergenic
1195401371 X:104464806-104464828 AAACTATTATGTGGCCTCCATGG - Intergenic
1196722508 X:118867933-118867955 AATTTATTTAGTCACATCCATGG + Intergenic