ID: 924361706

View in Genome Browser
Species Human (GRCh38)
Location 1:243248222-243248244
Sequence AGGTGATTAAAGGTGATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924361701_924361706 24 Left 924361701 1:243248175-243248197 CCATTCAGAAAGAAAGAGGATAC 0: 1
1: 0
2: 2
3: 31
4: 300
Right 924361706 1:243248222-243248244 AGGTGATTAAAGGTGATACAGGG 0: 1
1: 0
2: 1
3: 11
4: 151
924361702_924361706 -1 Left 924361702 1:243248200-243248222 CCTGATTTCTTATGAAGTATTTA 0: 1
1: 0
2: 2
3: 28
4: 351
Right 924361706 1:243248222-243248244 AGGTGATTAAAGGTGATACAGGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924361706 Original CRISPR AGGTGATTAAAGGTGATACA GGG Intronic
900901727 1:5521217-5521239 AGGTGATTAAAGTTAAAACAGGG - Intergenic
904837455 1:33348667-33348689 AGGGGATTAAAGATCAAACACGG + Intronic
917292635 1:173487139-173487161 TGGTGATAACAGGTGCTACAGGG + Intronic
921482731 1:215681464-215681486 AGATGTTTGAATGTGATACATGG + Intronic
922850507 1:228729858-228729880 AGGTGATGGCAGGTGATAAAAGG + Intergenic
923113266 1:230910152-230910174 AAGTGAGTCAAGGTGATTCATGG + Intronic
924361706 1:243248222-243248244 AGGTGATTAAAGGTGATACAGGG + Intronic
1063286001 10:4689119-4689141 AGGTGAATACTGGAGATACAAGG + Intergenic
1066227873 10:33402317-33402339 AATTGATTAAAGGGGAGACAGGG + Intergenic
1066757872 10:38729110-38729132 AGGTGTTTATAGGCTATACAAGG + Intergenic
1068655722 10:59574198-59574220 AGGTGAGAAAAGGCAATACAAGG + Intergenic
1073556085 10:104453137-104453159 AGGTTATTTAAGGTGAGAGAGGG + Intronic
1074407684 10:113193230-113193252 AGGTGATTAAAAGGGACACTAGG + Intergenic
1075658795 10:124179345-124179367 AGGAGATTAAAGGTGGGATATGG + Intergenic
1078381451 11:10845635-10845657 ATATGATTCAAGGTGATTCAAGG + Intronic
1078909768 11:15720020-15720042 GGGCTATTAAAGATGATACAGGG - Intergenic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1086817923 11:91396683-91396705 AGGTTATTGAAGGTGAGTCATGG + Intergenic
1090033755 11:123230398-123230420 AGGTGATTAAAGATGAAGCTGGG - Intergenic
1093563045 12:20565554-20565576 AGGTAGGTAAAGGTGATATAGGG + Intronic
1094010946 12:25808881-25808903 AGGTGAGAAAATGTGATACTTGG - Intergenic
1094633597 12:32202361-32202383 AGGTGAGAAAAGGTAATCCAAGG + Intronic
1098442061 12:70529326-70529348 AGGTGTATGGAGGTGATACATGG + Intronic
1100824923 12:98465677-98465699 AGATGATTTTAGGTGGTACATGG - Intergenic
1108535007 13:51366983-51367005 AGGTGGATAAAGGTTATAAATGG - Intronic
1114201834 14:20528290-20528312 AGGTCATCAAAGGTGATATTTGG - Intergenic
1117450275 14:55843286-55843308 AGGTCATAAAAGATAATACAAGG - Intergenic
1117678126 14:58175712-58175734 AGGGAATTAATGTTGATACAGGG - Intronic
1118733435 14:68685341-68685363 ATGTGATTAAAGCTGAGACAAGG - Intronic
1118935849 14:70287422-70287444 AGGTCCTTAAAGGTGAAAAAGGG + Intergenic
1120391533 14:83914568-83914590 AGATGATTAAATGTTAGACAAGG - Intergenic
1122022944 14:98854268-98854290 AGGTAATTTAAGGTGATTAAAGG - Intergenic
1130513499 15:84607955-84607977 AGGTGATTAGAGGTGCTCCCAGG - Intronic
1135986135 16:27185768-27185790 AGGTAATTTTAGTTGATACAGGG - Intergenic
1136055372 16:27684526-27684548 AGATGATTTTAGTTGATACATGG - Intronic
1138723410 16:59109026-59109048 AGCTGATTAAAGGAAATACTTGG - Intergenic
1138987788 16:62351945-62351967 TGGTGATTAAAGGTGATATATGG + Intergenic
1141481165 16:84307927-84307949 GGGTGATAAAAGGTGATAAAAGG + Intronic
1145392219 17:22464369-22464391 AGGGGTTTAAAGGTCATAGATGG + Intergenic
1148941599 17:51218077-51218099 AGGTAATTAAAAGTGATATGGGG - Intronic
1151006712 17:70446439-70446461 GGGAGATTAAAGGAGATCCAGGG - Intergenic
1151223193 17:72628854-72628876 AGGTGAGGAAAGGAGAGACAGGG + Intergenic
1152543076 17:80986788-80986810 AGGTGACAAAAGATGACACAAGG - Intergenic
1153551389 18:6264950-6264972 AGGTAATTAAACGCGTTACATGG + Intronic
1154074575 18:11187703-11187725 AGGTCCTTAAAAGTGAAACAGGG + Intergenic
1156647689 18:39185971-39185993 GGGAAAATAAAGGTGATACATGG - Intergenic
1156958732 18:42997009-42997031 AGATGTTTAAAGGTGACACAGGG - Intronic
1157488941 18:48108838-48108860 AGAAGATAAAAGGTGACACAAGG - Intronic
1158165137 18:54531683-54531705 AGGTGATTAAGGGAGAAAAAAGG + Intergenic
1163927724 19:20361665-20361687 AGGTGATTAAGGGAGAAAAAGGG - Intergenic
1166886881 19:45967010-45967032 AGATGATTTAAGGTGGTCCATGG - Intronic
1167622259 19:50566821-50566843 GGGTGATGAAAGGTCATAGAAGG + Intronic
926591236 2:14742380-14742402 AGGTGGTTAAAGGTGTTCCCAGG - Intergenic
926727714 2:16011501-16011523 AGGTGCTCAAAAGTGATGCAAGG + Intergenic
927738475 2:25545021-25545043 AGGTGAGTAAAGGATATAAAGGG - Intronic
931283934 2:60817085-60817107 AGATGATTAAAAGAGAAACATGG - Intergenic
932514747 2:72334338-72334360 ATGTGATGAAAGCTGATACTTGG - Intronic
937284020 2:120738515-120738537 AGGGGATTTAAGCTAATACAGGG + Intronic
937582233 2:123500780-123500802 GGTTGGATAAAGGTGATACATGG + Intergenic
939617499 2:144377645-144377667 AGGTGCTTAAAGGTGGGAAACGG - Intergenic
940069470 2:149669557-149669579 AGGAGATAAAAGCTGCTACATGG + Intergenic
941042167 2:160634841-160634863 AAGTGATAAAAAGTGGTACAAGG - Intergenic
941198017 2:162474186-162474208 AGGGGCATAAAAGTGATACATGG + Intronic
942393873 2:175525279-175525301 AGATGATTTAAAGTGTTACATGG + Intergenic
942779250 2:179621765-179621787 ATGTGATCAAAGGTGTGACACGG - Intronic
943509905 2:188811845-188811867 ATGGAATTAAAGGTGATTCAGGG - Intergenic
944353726 2:198760161-198760183 AGGTGAATTAAGGTAATTCAGGG + Intergenic
945399466 2:209363227-209363249 AGGTAATAAAAGGTGAGAAAAGG + Intergenic
1170392370 20:15889622-15889644 AGATGATTAAAGGACTTACAAGG - Intronic
1179486605 21:41714496-41714518 AGGTGAATAAAGGAAAAACAAGG - Intergenic
1179493345 21:41755809-41755831 AGGCCATCAAAGGAGATACAAGG + Intronic
1182177975 22:28313004-28313026 ACGTGATAAAAAATGATACAGGG + Intronic
1182559866 22:31151252-31151274 GGGTGAATAAATGTGGTACAGGG + Intergenic
1183278617 22:36919050-36919072 AAGTGACTAAACGTGATCCAAGG - Intronic
1184803581 22:46777167-46777189 AGGTGGTCACAGGAGATACATGG + Intronic
949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG + Intronic
953584736 3:44189330-44189352 AGGTGCTCAAACCTGATACAAGG - Intergenic
954788731 3:53114765-53114787 AGGTGGTAAAAGGTGATGGATGG + Intronic
955468748 3:59263952-59263974 AGCAGATTAAAGGTGAAAGAGGG - Intergenic
955555499 3:60132863-60132885 ATGTGATAAAAGGTGTTAGATGG - Intronic
957211151 3:77260521-77260543 AGGTGATTCAAGCAGATTCATGG + Intronic
960133622 3:114084315-114084337 AGTTGATTAAAGGTAACACCTGG + Intronic
961225349 3:125239895-125239917 AAGTGATTAATGGTGACCCAGGG + Intronic
962695999 3:137947956-137947978 AGTTGTTTAAAGGTGAAAGAAGG + Intergenic
962926752 3:140000681-140000703 AGCTGTTTAAAGGTGATCCCTGG + Intronic
963514954 3:146297659-146297681 ATGTAATTAAAAGTGTTACATGG + Intergenic
965546017 3:169917126-169917148 AGGTGATGTTAGGTGATCCATGG + Intronic
970115724 4:12694056-12694078 AGGTGATTTGACGTGATTCATGG + Intergenic
972889822 4:43543051-43543073 GGGTGATCAAAAGTTATACATGG + Intergenic
975031739 4:69628995-69629017 AGGTGATATCAGGTGATACATGG + Intronic
975479909 4:74866288-74866310 AGAATCTTAAAGGTGATACAAGG + Intergenic
977785805 4:101033800-101033822 AAGTGACTAGAAGTGATACAGGG - Intronic
977987145 4:103396452-103396474 ATGTGATAAAAAGTGATAAAGGG + Intergenic
978352119 4:107831061-107831083 AAGTGTTTAAAGGTGAAACAAGG + Intronic
978936652 4:114385763-114385785 AGGTGAGTAAAGGTTTAACATGG + Intergenic
979541622 4:121890228-121890250 AAGTAATTTAAGGTGTTACAGGG + Intronic
980621068 4:135304570-135304592 AGGTGATAGAAGGTGGTACGAGG + Intergenic
981018454 4:140000520-140000542 TGGTGATTAAAGGTCATTCTGGG - Intronic
982711908 4:158766814-158766836 AGGTGAATAAAGGAGATGTATGG + Intergenic
984649326 4:182252802-182252824 ATGTGATTAAATGAGACACACGG - Intronic
988697166 5:33633830-33633852 AGGGGAGTAAATGTGAGACAAGG - Intronic
988920700 5:35939057-35939079 GGGTAATTATAGGTGATTCAAGG + Intergenic
989257949 5:39386044-39386066 AGGAGATTAAATCTGGTACAAGG - Intronic
990346212 5:54874304-54874326 AGGTCATTAAAGTTGACAGATGG + Intergenic
990791819 5:59489440-59489462 ATGAGATTTAAGGTGATAAATGG + Intronic
992975379 5:82111943-82111965 AAGTGGTTAAAGGGCATACAGGG + Intronic
995331667 5:110954018-110954040 AGATGTTTAAAGGTGAAAGATGG - Intergenic
996143371 5:119942676-119942698 AGCTAGTTAGAGGTGATACAAGG - Intergenic
998731690 5:145084525-145084547 AAGTGATAAAAGGTGAAAAAAGG + Intergenic
999475357 5:151893134-151893156 AGGTGATTAGAAGTCAAACAGGG + Intronic
1000052261 5:157573910-157573932 AGGAGAGTAAAGCTGATTCAGGG - Intronic
1001054445 5:168437279-168437301 AGGTGATAAAAGGTGCTGTAGGG - Intronic
1004967266 6:20867852-20867874 TGGTGATTAAAGGCGATTCCAGG - Intronic
1008355770 6:50551267-50551289 AGATCATTAATGGTGATTCATGG + Intergenic
1009881824 6:69577099-69577121 AGGAGATTAAAGGTTATTAAAGG - Intergenic
1014698926 6:124658851-124658873 GGGAGATTAAAGGTGATGGATGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1018533135 6:164788628-164788650 AGGTGAATAAAGGTGATTGTAGG + Intergenic
1018963259 6:168463873-168463895 TGGTGATAAAATGTGATATAAGG - Intronic
1019030062 6:169002193-169002215 ATGTGATTTAAGATGATAAATGG + Intergenic
1021897831 7:25253970-25253992 AGGAGATTAGATGTGATTCATGG + Intergenic
1024756978 7:52545169-52545191 AGGTGATTAAATGTGATTGCAGG - Intergenic
1027663084 7:81010410-81010432 AGGTGCTTAATGATGATACATGG + Intergenic
1027782758 7:82540181-82540203 ATGCGATTAAAGGGAATACATGG - Intergenic
1028162850 7:87505722-87505744 AGGAGAGTAAAGATGACACAAGG - Intronic
1028655265 7:93198026-93198048 ATGTGATTAAAGGTGCAAGAGGG + Intronic
1030137046 7:106263669-106263691 ATATGATTAAAGGTGATTCAGGG - Intronic
1030137154 7:106265403-106265425 AGGGGAAAAAAGGTGAAACATGG - Intronic
1030630590 7:111891553-111891575 AGGTGAGCAAAGGTGATTCAAGG - Intronic
1031928167 7:127657900-127657922 ATGTGTTTAAGGGTGATAAAAGG + Intronic
1033143299 7:138847319-138847341 AGGTGAGCTTAGGTGATACAGGG - Intronic
1034240664 7:149608449-149608471 TGGTGATTAAAAGTAAAACAGGG - Intergenic
1034244722 7:149635760-149635782 TGGTGATTAAAAGTGAAACAGGG - Intergenic
1036922958 8:12875370-12875392 AGGTGAAGAAAGGAGATCCAGGG - Intergenic
1037980222 8:23247767-23247789 AGCTAGTTAAAGGTGATACCGGG + Intronic
1041452929 8:58026528-58026550 AAGTGATTACAGATGATTCAAGG - Intronic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1044692337 8:94894002-94894024 AGGTGATTTAAGGAGAAAGAGGG - Exonic
1045113576 8:98956593-98956615 AGTTCCTTAAAAGTGATACAAGG - Intergenic
1046330183 8:112703788-112703810 AGATGCTTGAAGGTGAGACATGG - Intronic
1046884008 8:119342541-119342563 AGGTGTTAACATGTGATACAAGG - Intergenic
1047947786 8:129899711-129899733 AGGTTTTTAAAGGAGAAACAAGG + Intronic
1047967701 8:130058813-130058835 GGGTGATTAAAGGAGAAACCAGG - Intronic
1048137762 8:131762779-131762801 ATGTGATAAAAGGACATACAAGG + Intergenic
1048662193 8:136617423-136617445 AGATGATTTCAGGTGGTACAGGG + Intergenic
1050763126 9:9098126-9098148 GTGTGATTTGAGGTGATACATGG - Intronic
1051099686 9:13506560-13506582 AGCAGATTAAAGCTGTTACATGG - Intergenic
1052589019 9:30466735-30466757 AGGTGATAAAAGGTGAAGCCAGG + Intergenic
1055656464 9:78454470-78454492 AGGTGATTAAAAGTGGTTGATGG + Intergenic
1055725062 9:79218615-79218637 AAGTGACTAAAGGAGGTACAGGG + Intergenic
1056491144 9:87108294-87108316 AGGTGAAGAAAGGTGAAAAAGGG + Intergenic
1056591074 9:87966557-87966579 AGGTGATTATAAAAGATACATGG - Intronic
1060610699 9:124961821-124961843 AGGTAGTTAAAAGTTATACATGG - Intronic
1060917431 9:127399375-127399397 AGGTGTTTAAAGGGGATTAAGGG - Intronic
1186874927 X:13807396-13807418 AAGTGATTGAAGGTGAAAGAGGG + Intronic
1187764768 X:22629054-22629076 AGCTGATTTCAGGTCATACAGGG - Intergenic
1188087264 X:25914938-25914960 AAGTGATTAAAGGTGATCTGGGG - Intergenic
1188800789 X:34527033-34527055 ATTTAATTAAAGGTGACACAAGG + Intergenic
1189707887 X:43778007-43778029 AGGTGGTTAAAGGTGGGATAGGG - Intronic
1197454677 X:126664416-126664438 AGGTCATTAATGGTCACACATGG + Intergenic
1198624610 X:138556360-138556382 ATGTGACTAAAAGTGATTCAAGG - Intergenic
1198697393 X:139356046-139356068 GGGTCATGAAAGGTGCTACAAGG - Intergenic
1200792227 Y:7309762-7309784 AGTGGATTAAAGTTGATCCAGGG + Intergenic
1200819233 Y:7565076-7565098 AGGTGAATGAAGGTGAGGCATGG - Intergenic