ID: 924362381

View in Genome Browser
Species Human (GRCh38)
Location 1:243255061-243255083
Sequence CGCGCCCCGCCTCCCCCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924362381 Original CRISPR CGCGCCCCGCCTCCCCCGTC CGG (reversed) Intronic
901344801 1:8530492-8530514 CCCGCCCCGCCTCCCCATTTTGG - Intronic
901500982 1:9652434-9652456 CGCGCCCCGCCTCCCAGTCCCGG + Intronic
901853965 1:12032231-12032253 GGGGCCCCCCCTCCCCCATCTGG - Intergenic
902215426 1:14931602-14931624 GGCTCCCCTCCTCCCCCGCCAGG + Intronic
902286122 1:15409813-15409835 CGCGCCCCGCCCCCGCCCCCGGG - Intergenic
902319694 1:15652445-15652467 CGCCCCCCCCCCCCCCCCTCCGG - Intronic
902375129 1:16026919-16026941 CCCGCCCCGCCGCCCCCGGGGGG - Intronic
905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG + Intronic
908272951 1:62437659-62437681 CGCCGCCAGCCTCCCCCGACCGG + Intronic
909496586 1:76285907-76285929 CCCGCGCCCCCTCCCCCATCTGG + Intronic
913323312 1:117605895-117605917 CTCGCCCCGCCCCTGCCGTCAGG + Intergenic
914713235 1:150234194-150234216 CCGCCCCCGCCTCCCCCGCCAGG - Intronic
914789908 1:150868608-150868630 CGCGCCCGGCCTGCCCAGGCTGG - Intronic
915519347 1:156432299-156432321 CCCGCCCCCCCGCCCCCGACTGG - Intergenic
916107205 1:161440969-161440991 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916108792 1:161448387-161448409 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916110380 1:161455768-161455790 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916111965 1:161463178-161463200 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916113552 1:161470559-161470581 CGCGCCCGGCCCCTGCCGTCGGG - Intergenic
916761344 1:167820364-167820386 CGCGCCTCGCCTAGCCCGCCTGG + Intronic
919899574 1:202034224-202034246 CCCCCCCACCCTCCCCCGTCTGG - Intergenic
921355503 1:214281238-214281260 CGCGCCCCGCCGCCACCATGAGG + Exonic
923727988 1:236523869-236523891 CGCGCCCCGCCTTCTGTGTCTGG - Intronic
923744298 1:236686399-236686421 CGCCCCCGGCCCCGCCCGTCGGG - Intergenic
924362381 1:243255061-243255083 CGCGCCCCGCCTCCCCCGTCCGG - Intronic
1064151444 10:12869001-12869023 CGCGCCCAGCCCCCACTGTCAGG + Intergenic
1064316567 10:14263230-14263252 CCCTCCCCGCCAGCCCCGTCTGG + Intronic
1065024384 10:21526604-21526626 CCCGCCGCGCCTCCCCCGCCTGG + Intergenic
1069837584 10:71319124-71319146 CGCGCCGGGGCTCCCCCTTCTGG - Intergenic
1070152160 10:73811624-73811646 GGCGCGCCGCCTCCCCCGGTGGG - Exonic
1070764929 10:79050878-79050900 CCAGCCCCACCTCCCCCATCTGG - Intergenic
1070954274 10:80454252-80454274 CGCGCCCCGCCCCCGCCGCTCGG + Exonic
1071527335 10:86366251-86366273 CGCGCACCCCCTGCCCCGTTGGG + Intronic
1073325910 10:102643979-102644001 CGCGCCCCGCAGCCCGCGCCCGG + Intergenic
1075697489 10:124447632-124447654 CGCCCCCCGCCGCCCCTGGCTGG + Exonic
1076878756 10:133230121-133230143 CGCGCCCCGCCCCGCCCGCCGGG - Intergenic
1076992100 11:280711-280733 CGCGCGCCGCCGCCCCCGGGAGG + Exonic
1077090911 11:777792-777814 CGCGCCCCGACACCGCCGCCTGG - Intronic
1077102969 11:830346-830368 CGGGCCCCGCCCCTCCCGCCAGG + Intronic
1077792948 11:5461255-5461277 CGCGCCTCGCCTCCACCCCCTGG - Intronic
1080002259 11:27363176-27363198 AGCGCCCCGCCGCCCACATCTGG + Exonic
1081845598 11:46238351-46238373 CGCGCCGCGCCGCCTCCGCCCGG - Intergenic
1081851488 11:46277934-46277956 CGCGCCCCGCGCCCCCCACCCGG + Exonic
1082986081 11:59172362-59172384 CGCGCGCCGCCGCCGCCGCCGGG - Intronic
1083454823 11:62771634-62771656 CGCGCACCCCCTCCCCGATCTGG + Intronic
1083635312 11:64117640-64117662 CGCTCCCCGCCTCCTCTTTCCGG + Exonic
1084274113 11:68043140-68043162 CTGGCCCCGCCTCCTCCTTCAGG + Intronic
1084516328 11:69639597-69639619 CCCGCGCCCCCTCCCCCGCCGGG - Intergenic
1084861702 11:72023028-72023050 CCTGCCCTGCCTCCCCAGTCTGG + Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1089306381 11:117528924-117528946 CGCCCCCCGCCCCCCCCCTTGGG + Intronic
1090627292 11:128618157-128618179 CTCTCCCCGCCTCCCCCAGCCGG - Intergenic
1091259688 11:134224650-134224672 CGCCCGCCCCCTCCCCCGCCCGG + Exonic
1096495444 12:52037130-52037152 CCCGGCGCGCCTCCCCCGGCGGG - Intronic
1098161312 12:67649547-67649569 CGCGGCCCGGCTCCCCCGCCGGG + Intronic
1102254006 12:111405873-111405895 CGCGGCCGGCCTCCCCCGCCGGG + Intergenic
1102679957 12:114684616-114684638 CGCTCTCCGCCTTCCCCGCCCGG - Intergenic
1103350143 12:120278264-120278286 CTCTGCCCGGCTCCCCCGTCTGG - Intergenic
1103400618 12:120640809-120640831 CGCACCGCGCCGCCCCCGCCGGG + Exonic
1103534704 12:121626640-121626662 CGGGCCCGGCCTCACCCGGCCGG - Exonic
1103917593 12:124384030-124384052 CTCCCCCCGCCTCCCCTCTCTGG - Intronic
1105512243 13:21060983-21061005 CGCGCCGCCCCTGCCCCGCCGGG + Intronic
1106483684 13:30155137-30155159 CTCACCCCGCCTCCCCCTGCAGG + Intergenic
1106517043 13:30465008-30465030 CGCGCCCCGCCGCCCCCGCACGG + Intronic
1107086361 13:36431663-36431685 CGGGCCGCGCCTGCCCCGCCCGG - Intergenic
1111822034 13:93227029-93227051 CGCGCGCCGGCTCCCCCGGGAGG - Exonic
1112091746 13:96090648-96090670 CGGCGCCCGCCTCCCCCGCCCGG + Intergenic
1114056130 14:18968065-18968087 GGCTCCCCTCCTCCCCCGCCAGG - Intronic
1114106421 14:19433688-19433710 GGCTCCCCTCCTCCCCCGCCAGG + Intronic
1114461162 14:22886971-22886993 CGCCCCGCCCCGCCCCCGTCCGG + Exonic
1114516358 14:23302353-23302375 CGGGCCCCGCCGCCTCCGGCTGG + Exonic
1114629047 14:24147612-24147634 CGAGCGCCGCCCCTCCCGTCTGG - Exonic
1115576238 14:34714661-34714683 CGAGCCCCGCCACCTCCCTCGGG - Exonic
1115610683 14:35046305-35046327 CGCGCCTCGCCTAGCCCGCCGGG - Intronic
1117690412 14:58299384-58299406 CGCGCCCCGCCTCCGCCGCTCGG - Intronic
1118845923 14:69547865-69547887 CGCGCCCCGCATCCCACGCTGGG + Intergenic
1118971648 14:70642431-70642453 CGCGCCCGGCCTCCCCGGCTGGG + Exonic
1119494467 14:75066806-75066828 CGCGCCACTCCACCCCCATCTGG + Intronic
1122221335 14:100240381-100240403 CGCGCGCCCCCGCCCCCGCCCGG + Intronic
1122550153 14:102545059-102545081 CGCGTCCCGGCTCCCCGGGCGGG + Intergenic
1122634359 14:103123269-103123291 AGCGCCCCGCATCCCCCGCTGGG + Intergenic
1122690157 14:103528468-103528490 CAGGCCCTGCCTCCCCCGACGGG - Intergenic
1122719862 14:103716013-103716035 CCCGCCCCGCCGCCCCGGCCCGG + Intronic
1126746408 15:51830017-51830039 CGCGCCCCACGTCCCCCGCCCGG - Intronic
1128143172 15:65316485-65316507 CCCGCCCCACCGCCCCCGACTGG + Intergenic
1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG + Intergenic
1132240625 15:100254837-100254859 TTCACCCCGCCTCCCCCGGCTGG - Intronic
1132364997 15:101251098-101251120 CGGGCACCGCCTCCTGCGTCCGG - Intronic
1132583058 16:694139-694161 CTCGCCCCGCCTCCCGCGCTGGG + Exonic
1132604477 16:788065-788087 CCCTCCCCGCCCCCACCGTCGGG - Intronic
1133771270 16:8868491-8868513 GGCTCCCCACCTCCCCCGCCGGG + Intronic
1134134143 16:11668573-11668595 CGGGCCCCGGCGCCCCCGCCCGG - Intronic
1134539988 16:15056224-15056246 CGCGGCCCGCCTCCTCCGCAAGG + Intronic
1135382915 16:22008676-22008698 TGCTCCCCTCCTCCCCGGTCCGG - Intronic
1136536464 16:30902554-30902576 CTCGCCCCGCCTCCTCCCGCTGG + Exonic
1136593418 16:31231750-31231772 CGCGCGCCGCCTCGCCTGACTGG + Intergenic
1136724813 16:32349010-32349032 CGCGCCCCGCCTCGCCCCTCTGG + Intergenic
1137713822 16:50585501-50585523 CGGGCCCCACGTCCCCCATCGGG - Intronic
1138561372 16:57802561-57802583 CGCGCGCCGCCGCCCCCCGCCGG - Exonic
1139402812 16:66696201-66696223 CGCGCCCCCTCTCCCTCGTGGGG - Intronic
1140458122 16:75116270-75116292 CGCGCCCCGCCCCCCACGAAGGG - Intronic
1140686010 16:77434727-77434749 TGCGCTCCGCCTGCCGCGTCTGG - Exonic
1141054814 16:80804710-80804732 CCCGCCCCGCCACCCCGGGCCGG + Intergenic
1141538639 16:84700452-84700474 CCCGGGCCGCCTCCCCCGGCCGG - Intronic
1141989422 16:87602066-87602088 CGCGCCTCGCCCCTCCCGCCGGG - Intronic
1141989645 16:87602675-87602697 CGGGCCCCGCCGCCGCCCTCGGG + Intronic
1142429717 16:90019486-90019508 CGCGCCCCGCCCCGCCCCGCGGG - Intronic
1203001617 16_KI270728v1_random:168745-168767 CGCGCCCCGCCTCGCCCCTCTGG - Intergenic
1203133220 16_KI270728v1_random:1705151-1705173 CGCGCCCCGCCTCGCCCCTCTGG - Intergenic
1143099844 17:4499019-4499041 CGCCCCCCGCCGCCCCGATCCGG + Exonic
1143719438 17:8799334-8799356 CCCGCCCCGCCTCTCCCTCCGGG - Exonic
1143750237 17:9022103-9022125 CGCGCCCCTTCTTCCCCGCCCGG - Intronic
1144269419 17:13602001-13602023 CGCGCCCCGCTGCGCTCGTCCGG - Intergenic
1144519744 17:15945675-15945697 CGCCCCCAGCCTGGCCCGTCTGG - Intronic
1144784387 17:17823711-17823733 CCCGCCCCGCCCCGCCCTTCGGG + Intronic
1145846406 17:28042251-28042273 CCCGCCCCCCCTCCCCAATCAGG + Exonic
1146256491 17:31393890-31393912 CGCCCCCCGCCGCCCCCACCAGG + Intronic
1146283361 17:31559229-31559251 CGCGCCCCGCGGCTCCCGGCGGG - Intergenic
1146787356 17:35731783-35731805 TGCCCCCCGGCTCCCCCGCCCGG - Exonic
1147469678 17:40647826-40647848 CTCGCCCCGCCCCTCGCGTCCGG + Exonic
1147989713 17:44325215-44325237 CGCGCGCCGCCACGCCCGGCTGG + Intergenic
1148830173 17:50426111-50426133 CGCGCCCCGCCCCGCCCCGCCGG + Intergenic
1148842556 17:50508364-50508386 CCCGCCCCGCCCCGCCCGGCTGG + Exonic
1148909143 17:50931211-50931233 CCCGCCCTCCCTCCGCCGTCCGG + Intergenic
1149660664 17:58332601-58332623 CGCGCCCCGCCCCCGCCCGCAGG + Intergenic
1151550248 17:74818511-74818533 CGCCCCCCGCCCCCCACCTCTGG - Intronic
1151555229 17:74843228-74843250 AGCGCCGCGCGACCCCCGTCTGG + Exonic
1152663106 17:81552113-81552135 CGCGAACCGCCGCCCCCGCCCGG + Intronic
1152689680 17:81712327-81712349 CGCGCCCCGCGCCCCGCGCCCGG - Exonic
1152699721 17:81812955-81812977 CGCCCGCCGGCTCCCCCGCCCGG + Intronic
1155007379 18:21741162-21741184 TGCTCCCCGCCGCCCCCCTCGGG + Intronic
1155199414 18:23503835-23503857 CGCGCGCCGCCTCCCGCGCTGGG - Intronic
1156350436 18:36297664-36297686 CCCGCCCCGCCCCCCGCGGCCGG + Intergenic
1158729905 18:60011153-60011175 CCTGCCCCGCCTGCCCCGCCTGG - Intergenic
1160616149 18:80130737-80130759 CCCGCCCCCCCGCCCACGTCAGG + Intronic
1160823014 19:1067099-1067121 CGCCCCCCGCTTCCGCCTTCGGG - Intronic
1160858710 19:1228710-1228732 AGCGCCCCGCGGCCCCCGCCCGG + Exonic
1160910447 19:1471482-1471504 AGCTCCCAGCCTCCCCCGCCAGG - Exonic
1160916543 19:1499390-1499412 CCCGGCCAGCCGCCCCCGTCCGG - Intergenic
1160947968 19:1652272-1652294 CGCGCCCCCCGCCCCCCGCCGGG + Intronic
1161277858 19:3428812-3428834 CCCCCTCCGCCTCCCCCGACCGG - Intronic
1161396342 19:4046922-4046944 GGCGCCCCCCCACCCCCGCCCGG - Exonic
1162394552 19:10409261-10409283 CGGGCCCTGCCTCCCTCGCCTGG + Intronic
1162396442 19:10420411-10420433 CGCCCCCCTCCTCCTCCGTCCGG - Intronic
1162834642 19:13308282-13308304 GGGGCCCTGCCTCCCCCGCCTGG - Intronic
1163585529 19:18161488-18161510 CGCCCCGCCCCTCACCCGTCGGG - Exonic
1164639032 19:29811716-29811738 CGCGCCCCGCGCCCCGCGCCCGG + Intergenic
1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG + Intergenic
1165242989 19:34482063-34482085 CGGCCCCCGCCGCCCCCGACCGG - Exonic
1165285564 19:34838937-34838959 CGCGCCCCTCGTCCCCCATCTGG - Intergenic
1165489645 19:36115729-36115751 CCCTCCCAGCCTCCCCCTTCCGG - Intronic
1166039111 19:40191584-40191606 GGGGCCCCGCCACCCCCGCCCGG + Intergenic
1166139617 19:40799148-40799170 CCCGCCCCGCCTCGCCCGGTGGG - Intronic
1166367439 19:42284553-42284575 CCCCCCCCGCCGCCCCCCTCCGG - Intronic
1166982414 19:46639188-46639210 CAGGCCCCGCCTCCGTCGTCGGG - Intergenic
1167376412 19:49114547-49114569 CCCGCCCCGCCCACCCCCTCCGG - Intronic
1167753359 19:51394510-51394532 CGCGCCTCGCCTTCTCCCTCTGG + Intergenic
1168719002 19:58544716-58544738 CGCGCCCCTCCTCCCCCCCTGGG + Exonic
925927665 2:8681861-8681883 CGCGCCCCGCCCACCCCGCGGGG + Exonic
926250950 2:11155300-11155322 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
926250967 2:11155329-11155351 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
926337399 2:11875027-11875049 CGCTCCCCTCCTCCCCACTCCGG + Intergenic
927151177 2:20196995-20197017 CCCGCTCCGCCTTCCCCATCAGG + Intergenic
927670512 2:25065074-25065096 TGTGCCCCGCCCCCCCCGCCAGG - Intronic
929983027 2:46699016-46699038 CGCGCCCTGCCTCCCTCCTTCGG + Exonic
931432831 2:62222457-62222479 GCCTGCCCGCCTCCCCCGTCTGG - Exonic
932699955 2:73985324-73985346 CCCGCCCCGCCACCCCCGCCCGG - Intergenic
932780233 2:74554700-74554722 CCCGCCCCGCCTCCCGCCGCAGG + Exonic
933858490 2:86441619-86441641 CTCGCCCACCCTCCCCCGTGGGG + Intronic
935255856 2:101308844-101308866 CGCGCCCCGCCTCGGCCCACAGG - Intergenic
936388699 2:112054284-112054306 CAGGCCCCGCCTCCCCACTCAGG + Intergenic
936388707 2:112054303-112054325 CAGGCCCCGCCTCCCCACTCAGG + Intergenic
937262410 2:120595076-120595098 CCCGCCCCGCCCCGCCCCTCTGG + Intergenic
937917742 2:127107195-127107217 CGCCCCCCGCCCGCCCCCTCCGG + Exonic
939969665 2:148644970-148644992 CCCGCCCCGCCGCCGCCGCCCGG + Exonic
941814431 2:169785678-169785700 CCCGGCCAGCCGCCCCCGTCCGG - Intergenic
942453312 2:176121984-176122006 CGCGCCCCGGCTCGCCCCTCGGG + Intergenic
948534564 2:238636302-238636324 TGGGCCCGGCCTCCCCTGTCGGG - Intergenic
1168760642 20:347581-347603 GGCGCCCCTTCTCCCCCGCCCGG + Intronic
1172661833 20:36573770-36573792 CGCGCGCCCCCACCCCCATCTGG - Intronic
1173508584 20:43607999-43608021 CGCGCACCGCCACGCCTGTCTGG - Intronic
1173741514 20:45405863-45405885 CTCGCCCCTCCACCCCCGCCTGG + Intronic
1174581701 20:51576854-51576876 CAGGCCCCTCCTCCCCAGTCTGG - Intergenic
1174874952 20:54217272-54217294 CGCCCCCCGCCGCCCCTTTCTGG - Intronic
1176285433 21:5016694-5016716 TGCCTCCCGCCTCCCCCGGCCGG - Intergenic
1178075372 21:29010812-29010834 CGCGCGCCGCCACCCCTGACTGG + Intronic
1178707837 21:34889584-34889606 CGGGCCCCGCGTCTCCCCTCCGG + Intronic
1179574707 21:42300718-42300740 CGCTCTGCGCCTCCCCCGCCTGG - Intergenic
1179576594 21:42312216-42312238 CGAGCCTCGCATCCCCCGGCCGG + Exonic
1179871748 21:44246781-44246803 TGCCTCCCGCCTCCCCCGGCCGG + Intronic
1179891678 21:44338774-44338796 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891692 21:44338809-44338831 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891706 21:44338844-44338866 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891720 21:44338879-44338901 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891755 21:44338958-44338980 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891769 21:44338993-44339015 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891784 21:44339028-44339050 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1181457940 22:23070310-23070332 CGCGCCGCGCCGCCGCCGGCAGG - Intronic
1182335557 22:29581124-29581146 CGCGCCCCGCCTCCGCCACCAGG - Exonic
1182435508 22:30327051-30327073 CCCGCCCACCCTCCCCCGGCGGG + Intergenic
1182903987 22:33920868-33920890 CGATCCCCGCCTCCCGCGCCCGG + Intronic
1183301557 22:37061399-37061421 TGCGCCCCTCCTCCCCAGGCTGG - Intronic
1183332783 22:37230253-37230275 CCCGCCCCACCTCCCCCTGCCGG - Intronic
1183535706 22:38399174-38399196 CCCCCCCCGCCCCCCCCGCCGGG - Intergenic
1183664025 22:39237110-39237132 CTCGCTCCCCCTCCGCCGTCAGG - Intronic
1184130618 22:42514637-42514659 CGAGCCCCGCATCGCCCGTGTGG - Intronic
1184140797 22:42576467-42576489 CGAGCCCCGCGTCGCCCGTGTGG - Intergenic
1185228843 22:49668579-49668601 CGGGCCCCGCATCTCCCGCCTGG - Intergenic
1185331383 22:50253480-50253502 CCCGCCCCCCCACCCCCGCCAGG - Exonic
1185368310 22:50446974-50446996 CCCGCCCCGCCCCGCCCGGCCGG - Exonic
949556207 3:5155664-5155686 CGTGCCCCCCCACCCCCGCCTGG + Intronic
950110718 3:10417058-10417080 CGCCCCCCCCCGCCGCCGTCTGG - Intronic
950524636 3:13516704-13516726 CGCCCCCCGCCTCCCCCGCCTGG - Intergenic
953881626 3:46693987-46694009 CGCGCCCCGCTTCCCCTGCAAGG + Intergenic
954110316 3:48429634-48429656 CGCCCCCGCCCTCCCCCGTGCGG - Intronic
954458314 3:50611819-50611841 CTCGCCCCGCCCCGCTCGTCTGG - Intronic
959085678 3:101849214-101849236 CGCCTCCCGCCTCCCGCCTCCGG - Intronic
961305610 3:125958064-125958086 CGCCCCCCGCCCCCCCCCCCAGG + Intergenic
961614779 3:128170135-128170157 CCCGCCCCGCCTCCCCCGCCTGG + Intronic
961755042 3:129122225-129122247 CCCGCCCCGACTCCGCCCTCAGG + Intronic
965649929 3:170923145-170923167 CGCGCCCCGCCACGCCTGACTGG + Intergenic
966201085 3:177359955-177359977 CGAGCCGCCCCTCCCCCGCCAGG + Intergenic
966762161 3:183428267-183428289 CGCGCCCCGGCTCCTCCGGCCGG + Exonic
968480429 4:830713-830735 TGCCCCCCGCCTACCCCTTCCGG - Intergenic
968583086 4:1403885-1403907 CGCGCCCCGCTTCCTCCCCCAGG + Intronic
968613737 4:1568289-1568311 CGGGCCCGGCCTGCCCCGGCTGG - Intergenic
969240215 4:5892544-5892566 CGGGGCCCGCCCCCCTCGTCTGG + Intronic
969379388 4:6783608-6783630 TGCGGCCCTCCTCCCCCGCCCGG - Intronic
970967925 4:21949002-21949024 CGCCCCCCGCATCCCCAGTCCGG - Intergenic
971207329 4:24583831-24583853 CGCCCTCCGCCTTTCCCGTCTGG + Intronic
974004744 4:56544738-56544760 CGCGCTCTGGCTCCGCCGTCTGG + Intronic
975118538 4:70705073-70705095 CGCCGCCGGCCTCCCCCGCCGGG + Intronic
978777068 4:112515321-112515343 CGCGCCCCGCCTGACGCGCCCGG + Exonic
979674668 4:123398319-123398341 CGCTCCCCGCGGCCCCCTTCCGG - Intronic
982584487 4:157220544-157220566 CGCGCGCCCCCTCCCCCGCACGG - Intronic
984754784 4:183314917-183314939 CCCGCACCTCCTCCCCCATCTGG + Intronic
986631952 5:9782447-9782469 CCCGCCCCGCCCCACCCATCAGG - Intergenic
988254958 5:28809338-28809360 CGGGCACCGCGTCCCCCGGCAGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992415777 5:76551002-76551024 CCCGGCCAGCCACCCCCGTCCGG - Intronic
992527855 5:77629793-77629815 CGCGACCCTCCTCCCGCGCCCGG - Exonic
994947766 5:106417448-106417470 CGCCGCCGGCCTCCCCCGCCGGG - Intergenic
997654286 5:135544065-135544087 CCCGGCCTGCCTCCTCCGTCTGG + Intergenic
998135393 5:139671643-139671665 CTGGCCCAGCCTGCCCCGTCTGG + Intronic
998401172 5:141849827-141849849 CGGCCCCGGCCTCCTCCGTCCGG - Intergenic
1000021013 5:157319669-157319691 CACTCCCCGCCTCCCCTGGCAGG + Intronic
1000210057 5:159100353-159100375 CGGGCCCCGCCTCCTCCCTTTGG - Intergenic
1002928780 6:1619813-1619835 CGCGGCCCGCCACTCCCGCCCGG + Intergenic
1003098112 6:3157654-3157676 CGCGCCCCGGCTCCCCCTCGCGG - Intergenic
1003212418 6:4079341-4079363 CCCGCCCGGCCTCCCCCGCGGGG + Exonic
1005883147 6:30075208-30075230 CGCGCCCAGCCTCACCTCTCCGG + Exonic
1005928975 6:30466637-30466659 AGGGCCCCGCCTCCCCCAGCTGG + Intergenic
1006829361 6:36959374-36959396 TCCGCCCCGCCTCGCCCGCCGGG - Intronic
1010001511 6:70954901-70954923 CCCCCCCCGCCGCCCCCGGCAGG - Intronic
1017164120 6:151391392-151391414 CGCGCACCGCCTCCGCCTCCCGG - Intronic
1017843880 6:158240541-158240563 CCCGGCCAGCCGCCCCCGTCCGG - Intronic
1017888743 6:158622056-158622078 CCCGCCCTGCCTGCCCCGTTGGG + Intronic
1019614155 7:1951360-1951382 AGCGCCCTGCCCCTCCCGTCCGG + Intronic
1019708647 7:2508344-2508366 CCCGACCCGCCTCCTCCTTCCGG + Intergenic
1022285893 7:28956258-28956280 CGCCCACCGCCTCCACCGTCAGG + Exonic
1022383925 7:29884530-29884552 CCCGCCCCGCCTGCCCCTCCGGG + Exonic
1022410446 7:30135424-30135446 CGCGCCCCGCGTGCTCCGCCGGG + Intronic
1023937168 7:44748539-44748561 CTGGCCCCGCCTCCGCCGCCCGG + Intergenic
1024043831 7:45574479-45574501 CGCGCCCCGGCGCCCCGGGCCGG + Intronic
1025078697 7:55964534-55964556 CGCGCGACCCCTCCCCCGGCCGG - Intronic
1026929567 7:74216291-74216313 CTCGCCTCCCCTCCCTCGTCTGG - Intronic
1028417576 7:90596340-90596362 CGCGCCGCGCCGCCGCCGCCCGG - Intronic
1031134912 7:117873623-117873645 CGCGCCCCGCGTCCCGCGCCCGG + Intronic
1034147404 7:148884732-148884754 CGCCCCGCCCCTCCCCCGCCCGG - Intergenic
1034219302 7:149431750-149431772 CGCGCCCCGCCGCCGCCGCCCGG - Exonic
1035356210 7:158277385-158277407 TGGGCCCGGCCTCCTCCGTCTGG - Intronic
1036797932 8:11769591-11769613 CGCACCCCGCCACCCCCTCCAGG + Intergenic
1038314599 8:26473086-26473108 CGCGCCCCTCCTCTCCAGCCTGG + Intronic
1038816386 8:30909401-30909423 CCCGCCCCCACTCCCCCCTCAGG + Intergenic
1041903522 8:63007849-63007871 AGCACCCCGCCTCCCCCCACAGG - Intergenic
1042306284 8:67336837-67336859 CGCGCCCGGCCTGCCTTGTCAGG - Intronic
1044229366 8:89757442-89757464 CGGCCCCCGCCTCCCCCAACAGG - Intergenic
1044712803 8:95073411-95073433 CGCGCCCCGCTGCCCCAGCCGGG + Intronic
1044857718 8:96493733-96493755 CGCGCCGCGCCTCCCTCCCCGGG - Exonic
1045327282 8:101126650-101126672 CGCCCCCAGCCGCCCCCGCCCGG + Intergenic
1045534472 8:103014256-103014278 CGAGTCCCGCCTCCCACCTCAGG - Intergenic
1049566033 8:143339708-143339730 CACTCCCCGCCTCCCCCACCAGG + Intronic
1049585406 8:143430504-143430526 GGCGCCCCCCCGCCCCCGCCGGG - Intergenic
1049601232 8:143508721-143508743 CGCCCCCCTCCACCCCCTTCAGG + Intronic
1049657024 8:143803544-143803566 CGCGCCCGGCTGCCCCCGTGGGG + Exonic
1049685609 8:143938106-143938128 CGGGCCCCGCCTGCCCCACCTGG - Intronic
1049718428 8:144104504-144104526 CGACCTCCGCCTCCCCCGGCCGG - Exonic
1049797696 8:144504080-144504102 TGGGCCCCGCCCCACCCGTCTGG - Exonic
1058412311 9:104747631-104747653 CCCGCCGCGCCTCCCGCGCCGGG + Intergenic
1058412377 9:104747883-104747905 CCCGCCCCTCCCCTCCCGTCGGG - Intronic
1060280777 9:122214173-122214195 CCCGCCCCGCCACCCGGGTCCGG + Intronic
1061478766 9:130886056-130886078 GGAGCCCCTCCTCCCCCGGCTGG + Intronic
1061540815 9:131277193-131277215 CGCCCCCCACCCCGCCCGTCCGG - Intergenic
1061666211 9:132162157-132162179 GGCGCTGCGCCTCCCCCCTCGGG - Exonic
1062012816 9:134275975-134275997 GGCCCCCCGCCCCCCCAGTCTGG - Intergenic
1062225162 9:135446369-135446391 GTTTCCCCGCCTCCCCCGTCTGG - Intergenic
1062377139 9:136267286-136267308 CGCCCCCTCCCTGCCCCGTCCGG - Intergenic
1062600261 9:137316127-137316149 GCCGCCGCCCCTCCCCCGTCTGG - Intronic
1185836092 X:3346736-3346758 CGCGCCCCGTCTCCCCGGGGTGG - Intergenic
1186056369 X:5654047-5654069 CGCCCCCCGCCCCCCCCCCCCGG + Intergenic
1189337128 X:40176763-40176785 CGCCCCGCGCCACCCCCGCCCGG + Intronic
1190300346 X:49053688-49053710 CCCTCCCCGCGACCCCCGTCTGG + Intronic
1192821615 X:74652444-74652466 CCTGCCCCTCCTCCCCCGACTGG + Intergenic
1200058824 X:153475002-153475024 CGGGCGCCCCCTCCCCCGGCCGG - Intronic
1200063614 X:153494728-153494750 CTCCCCCCCCCTCCCCCGCCTGG - Intronic
1200229514 X:154437073-154437095 CGCGCCCCGCCGCAACCGGCAGG - Exonic