ID: 924363048

View in Genome Browser
Species Human (GRCh38)
Location 1:243261092-243261114
Sequence ATGAGGCTTATGGCCAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924363048 Original CRISPR ATGAGGCTTATGGCCAAATT GGG Intronic
901159214 1:7162293-7162315 ATGAGGATTATGTCCAACTGTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
911045599 1:93624901-93624923 ATGACTCTTAGGGCCAAAGTGGG - Intronic
911408801 1:97475728-97475750 ACTAGGCTGGTGGCCAAATTTGG + Intronic
912699862 1:111869361-111869383 CTCAGGCTGATGGACAAATTTGG - Intronic
915079760 1:153344170-153344192 GAGAGGCTTTTGGCCAAGTTAGG - Intronic
915796392 1:158738712-158738734 AAGGGGCTTCTGGCCAATTTCGG - Intergenic
917657407 1:177140351-177140373 AGGAGGCTCAGGGCTAAATTAGG - Intronic
918852944 1:189715954-189715976 ATGAGTATTCTGTCCAAATTTGG - Intergenic
920563944 1:206959072-206959094 ATGAGGCTTATGGTTAACATAGG + Intronic
923377672 1:233380577-233380599 ATGAGGTTTATGTCCAGATGTGG + Intronic
923572034 1:235125160-235125182 ATGAGGCTTGAGGTTAAATTTGG - Intronic
924356598 1:243183584-243183606 ATAAAGCTTAAAGCCAAATTCGG - Intronic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
924395590 1:243616413-243616435 ATGAGATTTATGCCCAAAGTTGG - Intronic
924400915 1:243680538-243680560 ATGAGGCCTAAGGCCACATTGGG - Intronic
1065975887 10:30842090-30842112 ATTAGGCTTTTGGCCAGACTTGG - Intronic
1066800716 10:39186153-39186175 TTGAGGCTAATGGCAAAAATGGG - Intergenic
1066977619 10:42384139-42384161 GTGGGGCTTCTGGCCAATTTTGG + Intergenic
1067190025 10:44061228-44061250 ATGCGGCTGATGGCAGAATTGGG + Intergenic
1070739972 10:78896433-78896455 ATGGGGCTGATGGCCTGATTCGG + Intergenic
1071784773 10:88886880-88886902 ATGATGATTATGGCTAAATTTGG + Intronic
1071799874 10:89047236-89047258 ATGAGGATTAAGGAGAAATTAGG - Intergenic
1071815181 10:89225117-89225139 ACTAGCCCTATGGCCAAATTAGG - Exonic
1072312672 10:94171685-94171707 ATTAGGCTTAAGGGCAAGTTGGG - Intronic
1074436140 10:113436104-113436126 ATGAGGCTGATGCCCAGATCTGG - Intergenic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1075639944 10:124057190-124057212 ATGAGTGTTATGGCCAAAAGGGG - Intronic
1076327384 10:129636423-129636445 ATGATGCTTATAGCCCAGTTTGG + Intronic
1081066977 11:38555085-38555107 AACAGGCTTGTGGCCAATTTTGG + Intergenic
1087815397 11:102652938-102652960 AGGAGGCTTATACCCAAATGTGG - Intergenic
1087960942 11:104348171-104348193 ATGAGGTTTATGGCTACATCTGG - Intergenic
1088313314 11:108483227-108483249 ATGAGGCTTATAGCCAAGCTGGG - Intronic
1089672897 11:120068696-120068718 GTGAGTCTTATGGCGAACTTGGG + Intergenic
1091349427 11:134881216-134881238 CTGAGGCTCATGGCCAATTAAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092523063 12:9292934-9292956 ATCAGGCTTATGGACAATTCTGG + Intergenic
1092544228 12:9438963-9438985 ATCAGGCTTATGGACAATTCTGG - Intergenic
1093147536 12:15584635-15584657 ATTATGCTTATGGCCAAAAGGGG - Intronic
1098064661 12:66601169-66601191 ATGAGGAGACTGGCCAAATTGGG - Intronic
1099907840 12:88792890-88792912 ATGAAGATTATGGCCCATTTGGG - Intergenic
1101444972 12:104731150-104731172 ATGAGGGTTCTGGTCAATTTGGG - Intronic
1101678506 12:106941980-106942002 TTGAGGCTTATGGCAAAAGCCGG - Intergenic
1107593469 13:41934963-41934985 TTTAGGCTTATGGACAATTTTGG + Intronic
1111688503 13:91530848-91530870 ATTAAGAATATGGCCAAATTGGG - Intronic
1116128389 14:40819561-40819583 TTTAGGCTTATGGCAAAATCGGG - Intergenic
1117219584 14:53589632-53589654 TTTAGGCTTATGGCACAATTAGG + Intergenic
1118789899 14:69080877-69080899 ATGAAGTTTGTGGCCAAATGGGG + Intronic
1119215973 14:72869303-72869325 ATGAAGCTTATGGTCCACTTGGG - Intronic
1120363592 14:83537813-83537835 TTAAGACATATGGCCAAATTGGG + Intergenic
1123691929 15:22845416-22845438 ATGAGGCATATCACCAAATAAGG - Intronic
1125370894 15:38975241-38975263 GTAAGGCTAATGGCCAATTTGGG - Intergenic
1126243392 15:46472782-46472804 AGGAGGATCCTGGCCAAATTTGG - Intergenic
1126467612 15:48975292-48975314 ATAAGGATTGTGGCTAAATTAGG - Intergenic
1127144032 15:56006813-56006835 ATGATGCTGATGGCAGAATTTGG + Intergenic
1127513896 15:59673097-59673119 ATGATGCTTATGGTTAAAGTGGG + Intronic
1130617768 15:85428550-85428572 CTGAGGCTTCAGGCCAAACTTGG - Intronic
1131335495 15:91545000-91545022 ATTACTCTGATGGCCAAATTTGG - Intergenic
1134025543 16:10950234-10950256 ATGATTCTTATGTTCAAATTGGG - Intronic
1134327768 16:13222541-13222563 ATCAGTCTCATGGCCAAATGTGG + Intronic
1134413174 16:14020447-14020469 TTGAAGCTTATAGCCAAATTTGG + Intergenic
1134754988 16:16659085-16659107 ATGAGGTTTATAGCCCAATGGGG - Intergenic
1134991075 16:18700064-18700086 ATGAGGTTTATAGCCCAATGGGG + Intergenic
1137021989 16:35437042-35437064 TTGAGGCTTAAGGCTAAATTTGG + Intergenic
1139963995 16:70735335-70735357 CTGATGCTTCTGGCCAAGTTTGG - Intronic
1149379592 17:56080173-56080195 ATGATGCTGAAGTCCAAATTAGG + Intergenic
1150606260 17:66693617-66693639 ATGAGGCTCACGGCCAGAGTTGG + Intronic
1151037248 17:70815130-70815152 TGGAGACTTATGGCCAAAATAGG + Intergenic
1156064505 18:33123742-33123764 ATGAGCCTTGTTGCCAATTTGGG + Intronic
1158111970 18:53950124-53950146 ATGAGGCTTATGGGGAAACAAGG + Intergenic
1158863898 18:61619143-61619165 GAGAGGCTTCTGGCCAATTTTGG - Intergenic
1159133673 18:64310384-64310406 ATGAGTCTTCTGTCCAATTTTGG + Intergenic
1161215191 19:3091380-3091402 ATGGAGCTGATGGCCAATTTGGG + Intergenic
1164434057 19:28213178-28213200 AAGAGGCTTCTGGCAAATTTGGG + Intergenic
1166250597 19:41567748-41567770 ATTTGGCTTATGGCAAAGTTTGG + Intronic
1167225207 19:48234069-48234091 ATGAGGCTGAAGGCCACAGTGGG - Intronic
926958770 2:18331799-18331821 AGGAGCTTTATTGCCAAATTAGG - Intronic
927614177 2:24573580-24573602 ATGAAGCTTATATCTAAATTTGG + Intronic
928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG + Intronic
930399603 2:50866221-50866243 CTGTGGCTAATGGCCACATTAGG + Intronic
933292384 2:80452494-80452516 ATGGGGCTGATTGCCAAAATGGG + Intronic
936942184 2:117895813-117895835 ATGTGTTTTATGGCCAAATGTGG + Intergenic
937782840 2:125859014-125859036 ATAAGGCTTAGGGCATAATTAGG + Intergenic
938231027 2:129659195-129659217 ATGAGGGGGGTGGCCAAATTTGG + Intergenic
938837763 2:135124771-135124793 AATAGGCTAATGGCCAGATTTGG - Intronic
941005534 2:160243349-160243371 ATGAGGCCCAGGGCTAAATTTGG + Intronic
943733815 2:191331878-191331900 ATGAAGCATATTGACAAATTAGG - Intronic
946052420 2:216874849-216874871 ATGAGTCTTCTGTCCCAATTTGG - Intergenic
947109336 2:226701394-226701416 ATGAGGCTTATAGCTGAGTTGGG - Intergenic
947396034 2:229687784-229687806 ATTAGCCTTATGTCTAAATTTGG - Intronic
1170123248 20:12934698-12934720 ATGAGTCATATGTGCAAATTTGG - Intergenic
1170124562 20:12949096-12949118 ATGAGTCATATGTGCAAATTTGG - Intergenic
1170926300 20:20727446-20727468 ATGATGCTTCTGGCCTCATTAGG + Intergenic
1178836398 21:36101142-36101164 ATTAGGTTTATGGCTTAATTAGG - Intergenic
1180833296 22:18917285-18917307 ATGAGGCTCATGGGCATGTTTGG - Intronic
1181066531 22:20308972-20308994 ATGAGGCTTATGGGCATGTTTGG + Intergenic
1181971952 22:26697508-26697530 CTGAGGCTTAGGGACAAATTAGG + Intergenic
1203283382 22_KI270734v1_random:142589-142611 ATGAGGCTTATGGGCATGTTTGG - Intergenic
952235551 3:31475621-31475643 ATGAGATTTATTGCTAAATTGGG + Intergenic
953337824 3:42108813-42108835 AGGAGCATTATGGTCAAATTGGG - Intronic
953535522 3:43774151-43774173 ATGAGGATTATGGCCATTTATGG + Intergenic
959696392 3:109253413-109253435 AAGAGGCTTATGGCCGGATGCGG - Intergenic
960255803 3:115510327-115510349 TTGAGGCTTATGGCCAGAGATGG + Intergenic
961335140 3:126171482-126171504 AGGAGCCTTCTGGCCAAGTTAGG - Intronic
961907511 3:130277663-130277685 AAGAGGCTCATGGCCTAATAAGG - Intergenic
965442388 3:168730266-168730288 ATGAGACTTGTGGCAAACTTGGG + Intergenic
967038096 3:185663177-185663199 GTGAGTCTAATGGCCACATTGGG - Intronic
968326283 3:197819824-197819846 TTGAGGCTTATTGAAAAATTTGG + Intronic
969342779 4:6552820-6552842 CTGAGCCTTATTGTCAAATTAGG - Intronic
970908415 4:21244975-21244997 ATGAAAGCTATGGCCAAATTAGG + Intronic
973336727 4:48964074-48964096 CTGAGGCTTGTGGTCAAATTTGG + Intergenic
973558801 4:52113421-52113443 ATATGGCTAATGGGCAAATTGGG - Intergenic
974863509 4:67552161-67552183 AGGGGGCTTCTGGCCAAGTTAGG + Intergenic
978015045 4:103733890-103733912 ATGGGGCTTATGGGGAAAGTAGG - Intergenic
978071556 4:104478492-104478514 ATTAGACCTATGGCCAAAATGGG - Intronic
979204821 4:118025921-118025943 ATGAAGCAAATGGCCACATTGGG - Intergenic
979245221 4:118496021-118496043 ATAAAGCTTAAAGCCAAATTTGG + Intergenic
979569442 4:122200691-122200713 ATGAGGCTTAAGGAGAAATTAGG + Intronic
985909289 5:2866370-2866392 CTGACGTTTATGGCCAAACTGGG - Intergenic
989834144 5:45963104-45963126 ATGAGGCTTATGGTGAAAAAAGG + Intergenic
992072100 5:73157662-73157684 ATGTTGCTTAGGACCAAATTCGG + Intergenic
992701655 5:79347059-79347081 ATGAGGCTTATTTTCAGATTAGG - Intergenic
994728685 5:103465917-103465939 ATGATTCTTATAGCCAAGTTTGG - Intergenic
996365015 5:122692034-122692056 ATGACATTTAGGGCCAAATTAGG + Intergenic
998285351 5:140855143-140855165 ATGAGGCTCAATACCAAATTTGG - Intronic
1001321385 5:170685133-170685155 AAAAGTCTTAGGGCCAAATTGGG - Intronic
1004718735 6:18245730-18245752 ATGTGGTTTATGACCAAATGTGG + Intronic
1006432857 6:34008479-34008501 ATGAAGCTTATGGTCAAGTGGGG - Intergenic
1007943247 6:45801815-45801837 AGAAAGCTTCTGGCCAAATTTGG + Intergenic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1014248073 6:119088510-119088532 ATGATTCTTCTGGCCAAAATGGG - Intronic
1014381288 6:120745567-120745589 GTCAGGCTTATGGCCACAGTAGG - Intergenic
1024112454 7:46161136-46161158 AAAATGCTCATGGCCAAATTTGG - Intergenic
1025838752 7:65123548-65123570 ATGGGGCTTATAGTCTAATTGGG + Intergenic
1025884314 7:65572415-65572437 ATGGGGCTTATAGTCTAATTGGG - Intergenic
1025889128 7:65630189-65630211 ATGGGGCTTATAGTCTAATTGGG + Intergenic
1028187941 7:87811254-87811276 ATGTGAATTATGGCCAAATTGGG - Intronic
1028309164 7:89308864-89308886 AGGAGGCTGAAGGCCAGATTTGG + Intronic
1030597898 7:111561906-111561928 TTTAGGGTTTTGGCCAAATTGGG - Exonic
1030722735 7:112888329-112888351 ATGTGTTTTATGGCCAAATATGG + Intronic
1032438074 7:131918636-131918658 ATGAGGGTTATTTCCAACTTGGG - Intergenic
1035257681 7:157642188-157642210 AAGAGGCTTACAGCCAATTTGGG - Intronic
1039480511 8:37869781-37869803 ATGAGACTGATGGGCAAATGTGG + Intronic
1040415688 8:47192813-47192835 CTGAGTCTTATTGCCAATTTTGG + Intergenic
1042474491 8:69231762-69231784 TTTAGGTTTATGGCAAAATTAGG - Intergenic
1048684982 8:136894723-136894745 ATGATTCTTATGGTCACATTAGG - Intergenic
1057519272 9:95748357-95748379 ATCAGGCTGAGGGCCAGATTTGG + Intergenic
1060601211 9:124879129-124879151 ATCATGCTTAGGGCCAAAATAGG - Exonic
1189985477 X:46549751-46549773 ATTAGGCTTAGGGACAATTTCGG - Intergenic
1190739018 X:53276123-53276145 ATGAATGTTTTGGCCAAATTAGG + Intronic
1192676126 X:73198862-73198884 ATGAGTCCTAGTGCCAAATTGGG + Intergenic
1194350187 X:92817680-92817702 ATGAGGCTTATTGAACAATTAGG + Intergenic
1194386264 X:93259072-93259094 ATGAGACTTTGGGCAAAATTTGG + Intergenic
1194671079 X:96733410-96733432 ATGTGGCTTATTGCCTCATTGGG + Intronic
1195965401 X:110425493-110425515 ATAAGGCTTTTGGCCAAAGCTGG - Intronic
1196222833 X:113131831-113131853 CTGAGGCTTACGGCTAATTTTGG - Intergenic
1198786558 X:140295201-140295223 ATGATGCTTATGTGCAAAATTGG + Intergenic
1200658507 Y:5934322-5934344 ATGAGGCTTATTGAACAATTAGG + Intergenic
1201725838 Y:17151334-17151356 ATGAAGATTATGAACAAATTAGG + Intergenic