ID: 924365630

View in Genome Browser
Species Human (GRCh38)
Location 1:243290421-243290443
Sequence TTTTCTATGGAGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924365630 Original CRISPR TTTTCTATGGAGAAATTGGA GGG (reversed) Intronic
901168674 1:7238185-7238207 TTTGCTATGGAAATACTGGATGG + Intronic
903047658 1:20576281-20576303 ATATCTATGGAGAAATAGGGTGG + Intergenic
903614933 1:24644461-24644483 TTTTCAAAGGAAAAATTGGAAGG + Intronic
904550898 1:31316877-31316899 TTTTTAATGGAGACATCGGATGG - Intronic
906933238 1:50189630-50189652 TTTTTTCCGGTGAAATTGGAGGG + Intronic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
911421143 1:97642212-97642234 TTTTCTATGAAGAAAGTCAATGG - Intronic
914726326 1:150330663-150330685 TTTTTTATGGAGAATGGGGATGG + Intronic
915862480 1:159460583-159460605 TTGTCTATGTAGAAATTCCAAGG - Intergenic
915959350 1:160251887-160251909 TTTTCTATTAAGTACTTGGAGGG + Intronic
916200678 1:162268349-162268371 TTTTCTCTGGATAAACTGAATGG + Intronic
917448129 1:175123926-175123948 CTTGCTATGGAGAAAATGGTTGG + Intronic
917558026 1:176112410-176112432 TTTTCTAAAAAGAAATTGAATGG - Intronic
918800112 1:188960691-188960713 TTTTCTGAGGAGAAATTCAAGGG + Intergenic
919581496 1:199380790-199380812 TTTTCAATGGGTAAATTGTATGG - Intergenic
921690943 1:218149412-218149434 TTTTCTATGAAGTATTTGAAAGG - Intergenic
922343411 1:224675985-224676007 ATTTCCTTGGAGAAATAGGAGGG - Intronic
922380672 1:225020961-225020983 TTTACCATGGAGAAGTAGGAAGG + Intronic
922818080 1:228465222-228465244 TTTTAACTGGAGAAATTGAATGG + Intergenic
923189045 1:231602784-231602806 TTTTCTAAGGATAAATTTGTAGG + Intronic
923496301 1:234528425-234528447 TTTTCTATGCACACATTCGAGGG - Intergenic
923696374 1:236256114-236256136 TTTTCCAAGGAGAGAGTGGATGG - Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924586916 1:245368241-245368263 ATTTCTATGGAGAAACTTGGGGG - Intronic
1063421184 10:5913641-5913663 TTTTCTTTTTAGAAATGGGAAGG + Intronic
1064037556 10:11926826-11926848 TCTTCCAAGGAGGAATTGGAGGG + Intronic
1065476652 10:26145436-26145458 TTTTCTACAGAAAAATTTGAAGG + Exonic
1066338950 10:34510275-34510297 TTTTGCATGGAGAAATGGGAAGG - Intronic
1068836538 10:61561100-61561122 TTGTCTAAGGAGGAATTTGAAGG - Intergenic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1071038964 10:81283198-81283220 TTTTCTGTGGAGAAACATGATGG + Intergenic
1071403139 10:85298169-85298191 ATTTCTATGGAGCAATGGCAAGG - Intergenic
1073950412 10:108802196-108802218 TTTTCTAAGGAGTCATTTGAAGG - Intergenic
1074229980 10:111524020-111524042 TTTTTTGGGGAGAAAATGGAAGG + Intergenic
1075139955 10:119823772-119823794 ATGTTTATGGAGAAATTGGCAGG + Intronic
1075609137 10:123837121-123837143 TTTTCTTTGGAGAATTCTGATGG - Intronic
1076502635 10:130949403-130949425 TTTTGTCTGGAGAAATTCCAGGG - Intergenic
1078076010 11:8161489-8161511 TTATCAATGGATAGATTGGAGGG - Intronic
1079275977 11:19038097-19038119 CTTTCCATGGAGAGATTGCAGGG - Intergenic
1079655534 11:22982508-22982530 TTTTCTATAGAGAAAAGGAAAGG + Intergenic
1079735509 11:23992891-23992913 TTTCCTAAGGAGAATTTAGATGG - Intergenic
1079798705 11:24841613-24841635 TTCTTTCTTGAGAAATTGGAAGG - Intronic
1079985889 11:27200608-27200630 TATTCTCTAAAGAAATTGGATGG - Intergenic
1080456347 11:32423102-32423124 TTTTCTAGGTAGAAATTAGGGGG + Intronic
1080545029 11:33308487-33308509 TTTTCTATGGAAATAATAGAAGG - Intronic
1081206243 11:40278988-40279010 ATTTCTATGGTGATATTTGAGGG + Intronic
1082986284 11:59173111-59173133 CTTTCTATGTAGAAATTCTAGGG + Intronic
1083733616 11:64667366-64667388 TTTGCCATGGAGCTATTGGACGG - Exonic
1085359105 11:75870035-75870057 TGTTCCATGTAGAAATTGGGCGG + Intronic
1086625185 11:88941733-88941755 TTTACAATGGAGATATTTGATGG + Intronic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1090564035 11:127966543-127966565 ATTTATATGGACAAATTAGATGG - Intergenic
1090581933 11:128170186-128170208 TTTACTAGGCAGAAAATGGAGGG + Intergenic
1093044418 12:14426409-14426431 TTTTCTTTGAAGAAATTAGATGG - Intronic
1093360191 12:18216445-18216467 TCTTCTTTGGAGAAATTGAATGG - Intronic
1093524014 12:20085653-20085675 GATTCTAGTGAGAAATTGGAGGG - Intergenic
1094720709 12:33060629-33060651 TTTTCTAGGGAGAAAAGGTAGGG + Intergenic
1095690391 12:45081949-45081971 TTGTGCATGGAGAAAATGGATGG + Intergenic
1096442125 12:51651837-51651859 TCTTCCCTGGAGAAATTGGCAGG - Intronic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1098900099 12:76103412-76103434 TTTTCTAGGGATAAAATGCAGGG + Intergenic
1099029308 12:77505576-77505598 ATCTCAATTGAGAAATTGGATGG - Intergenic
1099099210 12:78416360-78416382 TTTTCTATGGAGATTCTGGGTGG - Intergenic
1100021222 12:90071526-90071548 CTTTCCATGGAAGAATTGGAGGG + Intergenic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1101192271 12:102347347-102347369 TATTCTAGGGAGAAATTTGAAGG + Intergenic
1101796159 12:107976167-107976189 TTTTCCTTGCAGAAATTGGCAGG - Intergenic
1101847151 12:108371781-108371803 TTCTCTCTGGAGAAAATGAAGGG + Intergenic
1104524037 12:129501352-129501374 TTTTCAAAAGAGAAATTGCAGGG - Intronic
1104785978 12:131448243-131448265 TTTTAAAAGGAGAAATTGTAGGG + Intergenic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1105305803 13:19168187-19168209 TTTTCTGTAGAGATATAGGAGGG - Intergenic
1106845032 13:33729440-33729462 TGTTCTATTGAGAAATGGAAAGG + Intergenic
1108862865 13:54883691-54883713 TTATCAATGGAGACATTGGTGGG - Intergenic
1109747255 13:66641397-66641419 ATTTGTATGGAGAAAGTGCATGG + Intronic
1110473711 13:75888943-75888965 TTTTCTAAAGAGGATTTGGAGGG + Intergenic
1110674394 13:78223071-78223093 TTTTCTAATGAGACAATGGAAGG + Intergenic
1111151029 13:84253862-84253884 ATTTCTTTGGGGAAAATGGAAGG - Intergenic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1116286721 14:42983222-42983244 TTTTGTATTTAGAAATTGAAAGG - Intergenic
1116892126 14:50279267-50279289 TTTGCTGTTGAGAAATTTGAAGG - Intronic
1117140286 14:52784144-52784166 TTTTCCTTGGATAAATTGAAAGG - Intronic
1118047296 14:61984647-61984669 TCTTTTAGTGAGAAATTGGAAGG + Intergenic
1120234966 14:81880256-81880278 TTTTTTCTTGAGAAATTTGAAGG + Intergenic
1120238965 14:81927416-81927438 TTTTATATGGCTAAATTGTAAGG - Intergenic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1120963201 14:90143953-90143975 TTTGCTATGTAGGACTTGGACGG + Intronic
1121913338 14:97812845-97812867 TTAAGTATGGAGAAATTTGAAGG + Intergenic
1127152243 15:56087987-56088009 ATTTCTATGGAGAGAAGGGAGGG + Exonic
1127338676 15:58017496-58017518 AATGCTATGGAGAAATTTGAGGG - Intronic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1127887050 15:63210712-63210734 TTTTCTATTGAGAAAGGGGTGGG + Intronic
1127979030 15:64020825-64020847 GTTTCTATGGAGTAATGGAAAGG + Intronic
1128103238 15:65023110-65023132 TTTTCTAAGGGGAAATTAGGTGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1131330524 15:91495076-91495098 ATTTATATGGGGAAATTGTATGG - Intergenic
1131566888 15:93493974-93493996 AGTTCTATGGGAAAATTGGATGG + Intergenic
1132176581 15:99720739-99720761 TTTTCCATTGAGAAAATAGATGG + Intronic
1133588395 16:7217703-7217725 TTTTCTCAGAAGAAATTGAATGG - Intronic
1133605575 16:7384574-7384596 TTTCCCATGGGGAAATAGGAGGG + Intronic
1133710118 16:8393259-8393281 TTTGCTATGGAGGAAGGGGAAGG - Intergenic
1135637293 16:24089125-24089147 TATTCTATGGGGAAAATGCATGG + Intronic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139007218 16:62587493-62587515 TGGACTGTGGAGAAATTGGAAGG + Intergenic
1139466792 16:67158463-67158485 TTTTCTATGAAAAGATTAGAAGG - Intronic
1139694713 16:68665952-68665974 TTTACTGTGGAAAAACTGGAAGG + Intronic
1140034309 16:71360952-71360974 TTTTCTTTGGGGGAATGGGAGGG - Intronic
1140590645 16:76348199-76348221 TTTTGTACTGAGAAACTGGAAGG + Intronic
1143083459 17:4398154-4398176 TTTTCAATGAAGAAACTAGAGGG - Intergenic
1143825949 17:9607461-9607483 TTTTCTTTGGAGAGAATGGTGGG + Intronic
1146570828 17:33951082-33951104 TTTACAATGGAGAAAATGGATGG - Intronic
1146999345 17:37349896-37349918 TTTACAATGGAGAAATCTGATGG + Intronic
1150745321 17:67812088-67812110 TTATCTATGGTGAAATTTAAAGG + Intergenic
1150870362 17:68902418-68902440 TTTTAAATGGATAAATTGTATGG + Intronic
1150976649 17:70094880-70094902 TTTTCTGTGGACAAATTCTACGG - Intronic
1154514747 18:15150299-15150321 GTTTCTACGCAGAAATTGCATGG - Intergenic
1155684740 18:28534808-28534830 TTTTCTATAAAAAAATTGTATGG + Intergenic
1156320865 18:36020403-36020425 TTTCCTCTGGAGAAAATGAATGG + Intronic
1158520114 18:58164903-58164925 GTGTCTATGAAGCAATTGGATGG - Intronic
1158644550 18:59232970-59232992 TTTTCAAAGGAGAAATTCAAAGG - Intergenic
1159547693 18:69860196-69860218 TTTGCCATGGAGAAATAGCAGGG - Exonic
1164054843 19:21614012-21614034 TTTGCTTTGGAGAAATTACAGGG - Intergenic
1164208406 19:23076434-23076456 TTTGCTTTGGAGAAATTACAGGG + Intronic
1164243887 19:23414184-23414206 TTTGCTTTGGAGAAATTCCAGGG - Intergenic
1164280571 19:23764884-23764906 TTTGCTTTGGAGAAATTACAGGG + Intronic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1166235843 19:41455715-41455737 ATTTTTATGGATAATTTGGAAGG + Intergenic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
925654947 2:6136671-6136693 TATACTTTGGAGAAAGTGGAAGG - Intergenic
926585370 2:14680136-14680158 TTTTATACAGAGAAAATGGAGGG + Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
926842174 2:17093014-17093036 TTTTCTTTGGAGAATTAGTATGG + Intergenic
927845221 2:26468090-26468112 TTTTCCATGAAGAAAATTGATGG - Intronic
927935914 2:27076481-27076503 TTTGCAATGTAGAATTTGGAAGG + Intergenic
929551058 2:42892378-42892400 TTTTCTATAGAGAGATAGAATGG - Intergenic
932018294 2:68055839-68055861 ATTTCTATAGTGAAATTAGATGG + Intronic
932228143 2:70059522-70059544 TTTTCCATGGACAAAGGGGAGGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
933128524 2:78642783-78642805 TTTTCTATTTAGAAATTTTAGGG + Intergenic
934034681 2:88079021-88079043 TTTCCCATGGTGAACTTGGATGG - Intronic
935233314 2:101117917-101117939 TTCTGTATGGAGAAATTAGAAGG - Intronic
935616006 2:105082604-105082626 CTTTCTCTGGAGAAATGGGGAGG + Intronic
935642437 2:105303893-105303915 TTTTTGCTGAAGAAATTGGATGG - Intronic
936000702 2:108826760-108826782 GTTTCTTTGCAGAAATTGAAAGG - Intronic
936686967 2:114838667-114838689 ATTCCTAGGGAGAAATTGGAGGG - Intronic
937842394 2:126536770-126536792 TTTTCTATTCAGAAATGAGAAGG - Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
938838203 2:135129855-135129877 TTTTCAATGGAAAAACTGAATGG + Intronic
939413476 2:141862239-141862261 GTTTCTGTGGAGAAATTAGAGGG - Intronic
939668575 2:144980866-144980888 TTTTCTATGGGTAAAAGGGAAGG - Intergenic
939974192 2:148697321-148697343 TTTTCAATGGATAAATTGCAGGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942288434 2:174445054-174445076 TTATTTATGGAGAACTTTGAGGG - Intronic
942483180 2:176411425-176411447 TTTTCTTTGGAGATCTTGGGTGG - Intergenic
942593435 2:177569608-177569630 TTTTCTCAGGAGAAAATGAAAGG - Intergenic
942633878 2:177980599-177980621 TTTTTTATGAAGACATTGGTTGG + Intronic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943422102 2:187678645-187678667 TTAGCTAAGGAGAAATTGAAAGG - Intergenic
944003163 2:194867061-194867083 TTTTCTTTGTAAAAATTGCATGG + Intergenic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
944357903 2:198814414-198814436 TTATCTTTTGAGAAATTGCAAGG - Intergenic
944962053 2:204886241-204886263 TGGTTTATGGAGAAATGGGAGGG - Intronic
945387053 2:209214168-209214190 TTTACTATGGCAAAATTGCAGGG + Intergenic
946030408 2:216699268-216699290 TTTTCTTTGGAGAAAAGGTATGG + Intergenic
946608851 2:221436598-221436620 TTTTCTATGCAGAAAAATGATGG - Exonic
946661161 2:222001302-222001324 TTTTCTCTTGAGATTTTGGATGG + Intergenic
947002471 2:225472723-225472745 TTATCTAGAAAGAAATTGGATGG + Intronic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
948907801 2:240988078-240988100 TTTTCTATGGGAAAGTTGGCAGG - Intronic
1170020503 20:11832128-11832150 ATTTCTATAGAGAAGATGGATGG - Intergenic
1170615746 20:17948966-17948988 TTTTCTATATAGAAAGTAGAGGG - Exonic
1170787687 20:19481788-19481810 TTTTCTATGGAGTGAGTGCAAGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173398562 20:42703656-42703678 TTTTCTGTGTAGTAAATGGAAGG - Intronic
1173529933 20:43761394-43761416 GTTTCTAGGGAGAAATGAGAAGG + Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1177390180 21:20459039-20459061 TTTTCCATTGAGAAATAGAACGG - Intergenic
1177578131 21:22984468-22984490 GTGTCTAGGGAGAAACTGGATGG - Intergenic
1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG + Intergenic
1177844457 21:26272280-26272302 CTTTCCATGGAGATATTGTAGGG - Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180754473 22:18151134-18151156 ATTCATATTGAGAAATTGGAAGG + Intronic
1182162655 22:28138672-28138694 TTTTCTATGGACAAGTTGTTTGG - Intronic
1182168875 22:28206285-28206307 TTTTATAAGAAGAAATTTGAGGG - Intronic
1182570491 22:31233977-31233999 TTCTCTATAGAGCAGTTGGAAGG + Intronic
1183650565 22:39151364-39151386 TTCTCTATGGAGAAAGAAGATGG + Intronic
1183871155 22:40743414-40743436 TTTTGTATTGAGAAATTTTAAGG + Intergenic
949139923 3:619855-619877 TTTTCTCTGGAGAATCTTGACGG + Intergenic
949493317 3:4609645-4609667 TATTCAATGGAGAACATGGAGGG + Intronic
950270199 3:11608429-11608451 TCTTCTTTGGGGAAATTTGAAGG - Intronic
951407269 3:22316220-22316242 TTTTTTATGGAAAATTTGGTTGG - Intronic
952137686 3:30441743-30441765 TTTTCACTGGTGAAATGGGAAGG - Intergenic
953741068 3:45539744-45539766 TTTTATATGAACAGATTGGAAGG - Intronic
954716701 3:52530389-52530411 TGTACAATGGAGAAAGTGGAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956477929 3:69642978-69643000 ATTTCTCTGGTGAAATGGGAAGG + Intergenic
957195844 3:77066824-77066846 TTTTCTTTGGAGAAAATAGAAGG - Intronic
957244391 3:77699495-77699517 TTTTCTATGCTGAAAATTGATGG - Intergenic
957588060 3:82158267-82158289 TTTTTTAAGGAAAATTTGGAGGG - Intergenic
958993447 3:100874046-100874068 TATTCTCTAGAGACATTGGAGGG + Intronic
959002096 3:100976388-100976410 TTTTCTTAGGAGAATTGGGAAGG - Intronic
959151899 3:102617989-102618011 TTTTATATGGACAATTTGGTGGG + Intergenic
959844353 3:111015975-111015997 TTTTCTAATGAGAAATTTTAAGG - Intergenic
960489836 3:118302599-118302621 GTTAATATGGAGACATTGGAAGG - Intergenic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962138004 3:132757755-132757777 TTTTCCCTGGATTAATTGGACGG - Intergenic
963241315 3:143005560-143005582 TTATCAATCGAGAAAATGGAAGG - Intronic
964140998 3:153399122-153399144 TTAGCTGTGGAGAAATTTGAGGG - Intergenic
964484341 3:157172442-157172464 TTTACAATGGAGAAATCTGATGG - Intergenic
964998490 3:162919863-162919885 TTTTATATGGAGGAAATTGATGG - Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965237327 3:166142179-166142201 TTTTCCATCAAGAAGTTGGAAGG + Intergenic
965386577 3:168053739-168053761 TCTTTTATGGAGGAATGGGATGG - Intronic
965514170 3:169602887-169602909 ATTTCTATGGAGAAAATTGGTGG - Intronic
966760499 3:183413790-183413812 ATTTGTAAGGAGTAATTGGAAGG - Intronic
967334886 3:188333255-188333277 TTATATTTGGAGAATTTGGAAGG + Intronic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
969343069 4:6554376-6554398 GTTTCTATGGAGGAATTAGAGGG - Intronic
969646205 4:8430934-8430956 ATTTCTAGGTAGACATTGGAAGG + Intronic
970125486 4:12805190-12805212 TATCTTATGGAGAAATTGAAAGG - Intergenic
971730649 4:30375335-30375357 TGATTTATGGAGAAATTGGGAGG + Intergenic
972062818 4:34900074-34900096 TTTTCTAATGAGAACTTGGCTGG - Intergenic
972147368 4:36044364-36044386 TTTGCTATTGAGATATTGGGAGG + Intronic
972801310 4:42478514-42478536 TTTTCTAAGGTGAAATAGAATGG + Intronic
974158619 4:58107073-58107095 TTTTCTATGGAGACATTTTATGG - Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974236660 4:59190185-59190207 TTTTCTTTTGAGAAATGGAAAGG + Intergenic
975263958 4:72339740-72339762 TTTTCTAAGAAGTGATTGGAAGG - Intronic
975770692 4:77719121-77719143 TTTTCTGGGGAAAAATTGGTTGG - Exonic
976277110 4:83289305-83289327 TTTTCTGAGGAGAAATTCAAGGG + Intergenic
977051041 4:92128883-92128905 TTTTCTATGGGGAAATTAAGGGG + Intergenic
977051971 4:92139756-92139778 TGGTCTATGGAGAATTTGGATGG - Intergenic
978334600 4:107652173-107652195 TTTTCTGTGTAGAAATCAGATGG - Intronic
979013883 4:115406856-115406878 TTTTCTATTTGGAAATTTGACGG - Intergenic
979624865 4:122833019-122833041 TTTAGTTTGAAGAAATTGGAAGG + Intronic
979689869 4:123548502-123548524 TTGTCTAAGGAGAAATTAAATGG - Intergenic
980665236 4:135925057-135925079 TTTAATATGGAGCAATTGGGAGG - Intergenic
980758550 4:137197996-137198018 TTTTCTAAGTATACATTGGAAGG + Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981214229 4:142145236-142145258 TTTTCTGTGGAGAGATAGGTGGG - Intronic
981231199 4:142357508-142357530 TTTCGTAGGGATAAATTGGAGGG + Intronic
981536941 4:145809835-145809857 TTTTTTATGGATAATTTGGTGGG - Intronic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
982120517 4:152138795-152138817 ATTTCTATGGACAACTTGCAGGG - Intergenic
983875772 4:172872999-172873021 TTTTCGATGGAGTACTCGGATGG - Intronic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
985760972 5:1748503-1748525 TTACCTATGGAGAAAAGGGAGGG + Intergenic
987015029 5:13809277-13809299 TTTTATGGGGAGAATTTGGAAGG - Intronic
988630719 5:32928485-32928507 TGTTCTTTGGAGGAATTGAAGGG - Intergenic
989279869 5:39628315-39628337 TTTTATATGGAAAAATTGATGGG + Intergenic
989482342 5:41946460-41946482 TTTTCTATTGACATATTTGAAGG - Intergenic
990052223 5:51517834-51517856 TTTTCAATGGACAAAGTGGTTGG + Intergenic
990457586 5:56003183-56003205 TCTTCTATGGAGAGATTTGAGGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991325782 5:65430497-65430519 TATTCTTTGGAGAAACTGGATGG + Intronic
992269577 5:75051843-75051865 TTTTCTATGGGGAGACTGAAAGG - Intergenic
993227852 5:85191434-85191456 TTTGCTGTGGAGAAACAGGAGGG - Intergenic
993300400 5:86202195-86202217 TTTTTTCTGGAAAAATTTGATGG - Intergenic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993807585 5:92431518-92431540 TTTTGTATGGAGAACATTGAAGG - Intergenic
994041386 5:95263532-95263554 TGTTCTATCCAGAAATTAGAAGG + Intronic
994364299 5:98894683-98894705 TTATCTATTAAGAAATTTGAAGG + Exonic
994384066 5:99107534-99107556 TTTTTTATAGAGAAATTGCCAGG + Intergenic
994800322 5:104365742-104365764 TTTCCTATGCAGGAATTTGATGG + Intergenic
995025055 5:107410539-107410561 TTTTTTATGGAGCATTTTGAGGG - Intronic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
995938544 5:117549199-117549221 TTTTCTATAGAGAATGTAGATGG + Intergenic
996251408 5:121338113-121338135 TTTTCTATAAAGCAATTGAATGG + Intergenic
998318536 5:141207034-141207056 TATTCTCTGGAGAAATTTAATGG - Intergenic
998361381 5:141590983-141591005 TTTTCAATGGAGAAATAACATGG - Intronic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
999001497 5:147928718-147928740 TCATCCATGGAGAAATTGAAGGG - Intergenic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1001685066 5:173587483-173587505 TTTTCTGTGAAGAAATTTTAGGG - Intergenic
1003166690 6:3685600-3685622 TCTACTATGGAGAAATACGAAGG + Intergenic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005667609 6:28074064-28074086 TTTTCTATGGAGCAATCACAGGG + Intergenic
1005959126 6:30683920-30683942 TGTTCTAGGGAGAAACTGCAGGG - Intronic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1008022317 6:46593861-46593883 TTTTCTATGGACAAAGTAGGAGG - Intronic
1008042545 6:46817058-46817080 TTTTCTAGGGGAAAAATGGAAGG + Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1009305619 6:62086003-62086025 TTTGCTATGGAGAATCTGAAAGG + Intronic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1011871655 6:91901874-91901896 TTTTCAATGGAGAAATGTTAAGG + Intergenic
1011894072 6:92201899-92201921 TTTTGTATGGATAATTTGGTAGG - Intergenic
1011905512 6:92362283-92362305 TTTTCTATGGATAGGTTAGAGGG - Intergenic
1012030581 6:94056018-94056040 TTTTCTAAGTAGAAAATGTATGG - Intergenic
1013866065 6:114697650-114697672 TTTACTATTGAAAAATTGGGAGG - Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016673508 6:146736135-146736157 TTTTCTTTACAAAAATTGGATGG + Intronic
1017195098 6:151691829-151691851 TTTGCTTTTGAGAAATAGGAAGG - Intronic
1017743131 6:157424789-157424811 ATTTCTATGGAGAAATTCCCAGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018698748 6:166411009-166411031 TCTTCTATGGAGAAAATGTGAGG + Intronic
1019082937 6:169448218-169448240 TTTTCTATCGGGCAATTGGTGGG + Intergenic
1020025723 7:4898552-4898574 TTTTCAACGTAGAATTTGGAGGG - Intergenic
1022199017 7:28097783-28097805 TTTTGCATGTAGAAATGGGAGGG + Intronic
1022893472 7:34725018-34725040 TTTTCCATGTAGAAATTAAATGG - Intronic
1023243912 7:38179762-38179784 GGTTGTATGGAGAAATGGGATGG + Intronic
1023437301 7:40151862-40151884 TTTTCTAAGGATAACTTGGCAGG + Intronic
1023500023 7:40838498-40838520 TTTTGTTTGGAGTAATTGGAAGG + Intronic
1027526067 7:79270201-79270223 GTTTTTATGGACAAATTGGTGGG - Intronic
1027994080 7:85401613-85401635 TTTTCTGTAGATAAATTGGCTGG + Intergenic
1028158022 7:87454188-87454210 ATTTCTATTGAGAAACTAGAAGG + Intronic
1028653060 7:93171924-93171946 GTTTTTATGGATAAATTGGCAGG + Intergenic
1028711238 7:93911255-93911277 TTTTCTACCCAGAAATTGTATGG + Exonic
1030627664 7:111861251-111861273 TTTTATTGGGAGAAATCGGAAGG + Intronic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1030844952 7:114397999-114398021 TTCTCTCTTGAGAAATTCGATGG + Intronic
1030885486 7:114931442-114931464 TTTACTATGGAGAGATTTGAAGG + Intronic
1031670217 7:124533660-124533682 TAGTCTATGGAGAACATGGAGGG - Intergenic
1031679220 7:124650546-124650568 TTTTCTTTCGAGAAATTTAAGGG - Intergenic
1033652038 7:143351088-143351110 TTTCTTATGCAGAGATTGGAGGG + Intronic
1034552419 7:151830057-151830079 TTCTAGATGGAGAAATGGGATGG + Intronic
1034857538 7:154566032-154566054 TGTACTATGAAGAAATTTGAAGG + Intronic
1035285212 7:157801648-157801670 TTCTCTAGGGAAAAATTTGATGG + Intronic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1036612530 8:10362655-10362677 TTCTCTTGGGAGAAATTGGTGGG - Intronic
1039082396 8:33745731-33745753 TTTTCTGGGGAGAAATTCAAGGG - Intergenic
1039177511 8:34826117-34826139 TTTTCTGTGAAGAGATTGAAAGG + Intergenic
1042933605 8:74036637-74036659 TTTTTTATGGACAATTTGGTGGG - Intergenic
1044421454 8:92000462-92000484 TTTTCTATGAAAAAAATGTAGGG - Intronic
1044507076 8:93034406-93034428 TTTTCCATGAAGGAATAGGATGG + Intergenic
1045653324 8:104363056-104363078 TCTTCACTGGAGAATTTGGAGGG - Intronic
1045962958 8:107990150-107990172 AATTCTATGGACAAATTGAATGG + Intronic
1046148990 8:110198966-110198988 TTAGATATGGAGAAATTGAAAGG + Intergenic
1046212676 8:111098973-111098995 TATTCTATCAAGAAATTGCATGG - Intergenic
1047243070 8:123111303-123111325 TTTTCTTTGGAGAAATTTCCCGG - Intronic
1048134106 8:131729294-131729316 TTTGCTATGGAGACATTCTATGG + Intergenic
1049118109 8:140707715-140707737 CTTTCAATGGATAAATTGTATGG + Intronic
1050986976 9:12094721-12094743 ATTTCTATGAAGAATATGGAAGG - Intergenic
1051245344 9:15104799-15104821 TATAGTATGGAGAAATTGGGAGG + Intergenic
1054830701 9:69621468-69621490 TTATCCATGGAGAAACTGTATGG + Intronic
1055054553 9:72011744-72011766 TGATCTTTGGAGAAATAGGAAGG + Intergenic
1055135343 9:72823135-72823157 TTTTCAATGGAGTACTGGGAAGG + Intronic
1055556974 9:77484057-77484079 TTTTCTTTGGAGAACATGAAAGG + Intronic
1058636544 9:107043852-107043874 TTTTCTATGGAGTATGTAGAGGG + Intergenic
1059592043 9:115672231-115672253 TTTTGTTTTGAGCAATTGGATGG + Intergenic
1060431576 9:123555416-123555438 TTTTCTTTGGAGCAATTGGGTGG - Intronic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1186859823 X:13661323-13661345 TCTTCTAAGGAGAAATTAGAAGG - Intronic
1187010408 X:15272809-15272831 TTGATTATGGAGAAATTGGTTGG + Intergenic
1187094527 X:16132592-16132614 ATTTCTATAGAGAAAATAGAAGG + Intronic
1189439356 X:41020498-41020520 TTTTCAATGAATAAATTGCAAGG - Intergenic
1189532242 X:41897660-41897682 TTTTCAATGGGAAAATGGGAAGG - Intronic
1192420519 X:71025882-71025904 TTTTTTTTGTAGAAATGGGAAGG - Intergenic
1194555282 X:95350815-95350837 TTTTAAATGGAGAAATTAAAGGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197562355 X:128039023-128039045 ATTTCTATGGAAAAGTTAGACGG - Intergenic
1197632759 X:128881121-128881143 TTTTGGTTGGAGCAATTGGATGG - Intergenic
1199038539 X:143082188-143082210 GTTTCGATGGAGGAATTGAAAGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200299499 X:154958446-154958468 TTTTCCATGGAGAATTTTGAAGG - Intronic
1200961088 Y:8996815-8996837 TTTTAAATGGAGAAATTGAGAGG - Intergenic