ID: 924367150

View in Genome Browser
Species Human (GRCh38)
Location 1:243307021-243307043
Sequence CTGAAAAATGAGACTACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924367150 Original CRISPR CTGAAAAATGAGACTACTGA AGG (reversed) Intronic
902847809 1:19125937-19125959 CTGGAAAATGAGCATACAGATGG - Intronic
906943505 1:50276128-50276150 CTGATAGATGAGAAAACTGATGG + Intergenic
907338752 1:53718587-53718609 CTGAAAAAGTAGACTCCAGAGGG + Intronic
909338272 1:74501851-74501873 CTGGCAGATGAGACTTCTGAGGG + Intronic
912710555 1:111946687-111946709 CTGAAAAGTGAGAAGTCTGAAGG + Intronic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
918177859 1:182061033-182061055 CTGAAAAGAGAGTCTCCTGACGG - Intronic
919150045 1:193684839-193684861 GTGAAAAGTGAGACATCTGAGGG + Intergenic
920752237 1:208689912-208689934 CTGAAATATAAGTCTAATGATGG + Intergenic
921676417 1:217981570-217981592 CTGTAAAATGAGAAGACTAATGG - Intergenic
922115826 1:222613265-222613287 ATCAAAAATGACACTAGTGATGG - Intergenic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
923368607 1:233287839-233287861 CTGTAAAATGGGAATAATGATGG + Intronic
923700420 1:236294847-236294869 GTGAAGACTGTGACTACTGATGG - Intergenic
923710037 1:236380391-236380413 CTGGAAAATAAGAAGACTGAAGG + Intronic
923955151 1:239008829-239008851 CAGAAAGATGAGAATACTGAGGG + Intergenic
924286330 1:242491650-242491672 CTGACAAATGAGACTAGAGAAGG - Intronic
924367150 1:243307021-243307043 CTGAAAAATGAGACTACTGAAGG - Intronic
1063002559 10:1938462-1938484 CTGAAAAATGAAATTAACGAAGG + Intergenic
1064425925 10:15229244-15229266 CTGAAAAATGAAACAACAGCAGG - Intronic
1065005376 10:21374815-21374837 TTGAAAAAGGAGAATACTGTTGG + Intergenic
1065481898 10:26203719-26203741 ATGAAAAATGGGAGTAATGATGG + Intronic
1066233135 10:33457781-33457803 CTTGAAAATGAGCCTGCTGATGG + Intergenic
1067329561 10:45302318-45302340 TTGGAAAGTGAGACCACTGAGGG + Intergenic
1067797347 10:49330385-49330407 CAGTAAAATGAGGCTAATGAGGG - Intergenic
1068150332 10:53123001-53123023 CTGAAAAGTGAGACTGATGCTGG - Intergenic
1068941105 10:62682175-62682197 ATGAGAAATGGGAGTACTGAAGG + Intergenic
1071163788 10:82781531-82781553 CAGAAAAAGCAGACTAGTGATGG - Intronic
1071241014 10:83704881-83704903 TTAAAAAATGAGAGTAATGATGG + Intergenic
1071446565 10:85754199-85754221 TTGAAAAATGACATTTCTGATGG - Intronic
1073069272 10:100782978-100783000 CTGAAAAGGGAGAGTACAGAGGG - Intronic
1073811270 10:107154907-107154929 CTGTAAAATGAGGGTACTAATGG - Intronic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074281478 10:112055753-112055775 CTTAAAAATGAGAAAACTGAGGG + Intergenic
1074659407 10:115635737-115635759 TTTAAAAATGATACTACTGACGG - Intronic
1074955368 10:118383536-118383558 TTGAAAAATGGGGATACTGATGG + Intergenic
1075262930 10:120978564-120978586 CTGAAAAATAAGACTTTTGGGGG - Intergenic
1078302815 11:10150455-10150477 CTGGAGAATGGGATTACTGATGG + Intronic
1079621424 11:22560288-22560310 CTGAAAAATGTGAGTCCCGATGG + Intergenic
1080207420 11:29746473-29746495 GAGAAAAATGAAACTACAGAAGG - Intergenic
1080280985 11:30556233-30556255 CTGTAAAATGAGACTAATACTGG - Intronic
1080622859 11:34001763-34001785 CTGTAAGATGAGGCTAATGAAGG + Intergenic
1081298048 11:41416084-41416106 CTGAAAAATGGTAATACCGAGGG - Intronic
1081541958 11:44040992-44041014 CTGTAAAGTGAGTCTAATGATGG + Intergenic
1081777979 11:45689450-45689472 TTGACAAATGAGAAAACTGAAGG + Intergenic
1083419483 11:62545257-62545279 CTGCACAATGAGGCCACTGAGGG - Intronic
1084538090 11:69769622-69769644 GGGTAAAATGAGACTACTGGGGG - Intergenic
1085150384 11:74248002-74248024 CTGGAAAATGAAAAAACTGATGG + Intronic
1085217956 11:74848831-74848853 CTGAAGAATGAGACTACTGAGGG - Intronic
1085483167 11:76839320-76839342 CTGCAAAATGAGGAGACTGAGGG - Intergenic
1085539151 11:77250249-77250271 TAGAAAATTGGGACTACTGAAGG - Intronic
1085815108 11:79728594-79728616 CTGAAAAAAGAGAAAACTCAGGG - Intergenic
1085816117 11:79739053-79739075 ATGAAAAATGAGGATACAGAAGG - Intergenic
1086804439 11:91222664-91222686 CTGAAAAATGTGACACTTGATGG - Intergenic
1086922902 11:92607295-92607317 CTGAAAGAGGAGACTAAGGAAGG + Intronic
1087735507 11:101828063-101828085 GTAAAAAATGAGAATACTAAGGG - Intronic
1089221744 11:116877784-116877806 CTATAAAATGTGGCTACTGAGGG + Intronic
1089316144 11:117592713-117592735 CTGAAAAATGAGGCCAATGATGG - Intronic
1091436364 12:476176-476198 CTGTAAAATGGGACTATTAATGG + Intronic
1093089294 12:14903860-14903882 CAGAGAAATGAGACTTGTGAAGG + Intronic
1093775389 12:23067878-23067900 CTGAAAACTGAAATTACAGATGG - Intergenic
1094188670 12:27673804-27673826 CTGAAGAAAGAGACATCTGATGG + Exonic
1094640930 12:32274880-32274902 CTGTAAAATGGGACTAATAATGG + Intronic
1095324379 12:40870302-40870324 CTGGAAAATGGGACTACTCATGG + Intronic
1096260838 12:50090031-50090053 CTTTAAAGTGAGACTGCTGACGG - Intronic
1097313127 12:58143037-58143059 CTGTAAAATGAGGATAATGATGG - Intergenic
1097355223 12:58593654-58593676 CTGAAAAATGTAACATCTGAAGG + Intronic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1099237267 12:80096360-80096382 TGGAAAAATGAGACTTCAGAAGG + Intergenic
1100294928 12:93252166-93252188 CTGAAAGATGAGACTCCCGTTGG - Intergenic
1101058828 12:100949413-100949435 CTGCAAAATGAGGCTAATAATGG + Intronic
1101659926 12:106756680-106756702 CTGAAAAATGAGGATAATTATGG + Intronic
1102462482 12:113108511-113108533 CTGTAAAATGGGACTCATGATGG - Intronic
1107120084 13:36786710-36786732 CTGAGAAAGGAAACTACTCATGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109143363 13:58745283-58745305 CTAAAAACTGAGCCTCCTGAAGG - Intergenic
1109486553 13:63029419-63029441 CTGGAAAATGGGATAACTGAAGG - Intergenic
1112054925 13:95681652-95681674 CTTTAAAATGAGACTAATCAGGG - Intronic
1112533265 13:100224780-100224802 CTGAAAAGTGAGATTGATGATGG + Intronic
1113042860 13:106123638-106123660 CTGAAGAAGGAGACAAGTGATGG - Intergenic
1113382800 13:109818905-109818927 CTGAAAAAAGAGTATATTGAAGG + Intergenic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1115082109 14:29467193-29467215 GTGAGAAAGGAGAATACTGATGG - Intergenic
1116620049 14:47189990-47190012 CAGATAAATGAGACAAATGATGG - Intronic
1116972679 14:51082998-51083020 CTGTAAAATGAGAATAGTAATGG + Intronic
1119544606 14:75462486-75462508 CTGTAGAAAGAGACTAATGAAGG - Intronic
1119931857 14:78555090-78555112 CTGTAAAATGAGATCACTAATGG + Intronic
1120655060 14:87179522-87179544 GGGAAAACTGAGACTACAGAGGG - Intergenic
1121071759 14:91029626-91029648 CTGTAAAATAAGACTGCTAATGG + Intronic
1122335227 14:100971130-100971152 GTGAAAATTGAGACCAATGATGG + Intergenic
1122794427 14:104198906-104198928 GTGAAAAATGAGGCTAAGGAAGG - Intergenic
1124039949 15:26092588-26092610 CATATAATTGAGACTACTGAAGG - Intergenic
1124194747 15:27613602-27613624 ATGATAAATGAGATGACTGATGG + Intergenic
1126268987 15:46790474-46790496 CTGGAAAGTGACAATACTGATGG - Intergenic
1127272044 15:57410251-57410273 ATGTAAAATGAGAAAACTGAAGG - Intronic
1127653147 15:61029025-61029047 CTGAAATAAGATAGTACTGATGG + Intronic
1128152539 15:65372301-65372323 CTGAAAATTGAGACTTGTTAAGG - Intronic
1128610619 15:69070209-69070231 CTCAAAAATCAGACGACTGTTGG - Intergenic
1128912351 15:71527414-71527436 GTGAAAAATGTGACAACAGAAGG + Intronic
1130140664 15:81223594-81223616 CTGTAAAATGAGGATATTGATGG + Intronic
1132243998 15:100280511-100280533 CTGAGAAGTGGGACCACTGAAGG - Intronic
1132371736 15:101304321-101304343 CTTAAAAACGAGTCTTCTGAAGG + Exonic
1133005132 16:2876180-2876202 CTCAAAAATGAGAAAAGTGAGGG + Intergenic
1133850870 16:9502158-9502180 CTGAAAAAGGAGAGTCCTAATGG + Intergenic
1135343871 16:21671240-21671262 CTGTAAAATGAGATTAATGATGG - Intergenic
1136178043 16:28532052-28532074 CTCAAAAAGGAGAAAACTGAGGG + Intergenic
1138064089 16:53922543-53922565 CCGACAAAGGAAACTACTGATGG + Intronic
1139118848 16:63990743-63990765 CTATAAAATGAGACTATTCATGG - Intergenic
1139189538 16:64845753-64845775 ATGAGAAATGAAACTACTGCTGG + Intergenic
1140392026 16:74595534-74595556 CTCAAAAAAGAAAGTACTGAAGG + Intronic
1140518007 16:75558331-75558353 CTGAAAGATGAGACAAGTGGAGG + Intergenic
1144541666 17:16148194-16148216 GTGAGAAATGAGGCTGCTGAGGG - Intronic
1145415247 17:22709232-22709254 CTACAAAATGAAACTACAGAAGG - Intergenic
1146976518 17:37117803-37117825 CTGAAAATTGACATTAGTGAAGG - Intronic
1147495147 17:40908326-40908348 CTGAAAAATGGGCCAACAGAAGG + Intergenic
1147814949 17:43202720-43202742 CTGAAAAAAGAGACTGCACAAGG - Intronic
1148848548 17:50542897-50542919 CTGAAAAATGGGAGTAGTGCCGG - Exonic
1151341999 17:73477529-73477551 CTGTAAAATGGGAATAATGATGG + Intronic
1153552339 18:6274678-6274700 TTTAAAAAAGATACTACTGATGG + Intronic
1153779994 18:8486004-8486026 CTGAAAGCTGGGACTCCTGAAGG - Intergenic
1155448635 18:25940667-25940689 CTGAAAATTAAGGCTACTTAGGG - Intergenic
1155566156 18:27136579-27136601 TTGAAAAATGGGAATACTAATGG + Intronic
1156425476 18:37007079-37007101 TTGAAAAAGGAGACTAGTGGAGG - Intronic
1156573798 18:38289533-38289555 ATGAAAAATGAATCTATTGAAGG + Intergenic
1157505926 18:48226511-48226533 TTCAAAAATGAGAAAACTGAGGG + Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157972826 18:52289948-52289970 GAGAAAAATGATACTATTGAAGG - Intergenic
1158239257 18:55358697-55358719 CTTAAAAATGAGCCTTCTAATGG - Intronic
1158248014 18:55453373-55453395 ATGGAAAATGTGACTAATGATGG - Intronic
1158992778 18:62887329-62887351 CTGAAAAATGAGACTAGAAGGGG - Intronic
1159375532 18:67587397-67587419 ATCAAAAATGAGACTATTTACGG + Intergenic
1159850547 18:73522089-73522111 CCTAAAATTGAGACTGCTGAGGG + Intergenic
1161956255 19:7497190-7497212 CTGCAAAAGGGGACTAATGATGG - Intronic
1164425473 19:28137767-28137789 CTGGAAGATGAGGCTTCTGAGGG + Intergenic
1167881156 19:52458509-52458531 TTGAAAAATGAAAATACAGAGGG - Intronic
1167888653 19:52522582-52522604 CTGAAAAAGGAGACCAATAAAGG + Intergenic
1167969862 19:53182467-53182489 CTGTAAAATGAGACGACTGTGGG - Intronic
926025097 2:9535229-9535251 CTGAAAAATGAGAAGACTCTGGG - Intronic
928312482 2:30222421-30222443 CAGTAAAATGAGACTAATGCTGG + Intergenic
929354349 2:41001627-41001649 CTGAAAAAAGAGAGCACTGGGGG + Intergenic
929750507 2:44707454-44707476 CTGAATAAGGATACTTCTGATGG - Exonic
930127368 2:47812133-47812155 CAGAAAATTGAGGCTACAGAAGG - Intronic
931872470 2:66476209-66476231 CTTAAAAATGAAAGTTCTGAGGG + Intronic
931932309 2:67153035-67153057 GTCAAAAATGAGATTACTGCAGG - Intergenic
933528820 2:83479041-83479063 ATGAAAAATGAGAAAATTGAGGG - Intergenic
934580373 2:95433094-95433116 CTGAAGACTGAGACTAATAATGG - Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
935623788 2:105151826-105151848 CTGTAAAATGGGACTAATAATGG - Intergenic
936396210 2:112133508-112133530 CTGTAAAATGAGATTAATAATGG + Intergenic
936502215 2:113075108-113075130 CTGCAGAATGAGAGTGCTGATGG - Intronic
936532418 2:113285620-113285642 CTGAAGACTGAGACTAATAATGG + Intergenic
936878049 2:117215930-117215952 CTGAAAACAGAGAGAACTGATGG - Intergenic
937531342 2:122830967-122830989 ATGAAAAATAAGAGTAATGAGGG - Intergenic
938122979 2:128646529-128646551 CTGAGGAATGAGGCTACTGTGGG + Intergenic
940169036 2:150806875-150806897 CTGACAATTGAGAATTCTGATGG - Intergenic
940936989 2:159506931-159506953 CTGAAAACTGGCACTACTGGTGG + Intronic
941473072 2:165914120-165914142 CTGAAAATGTAGACTACTAAAGG + Intronic
941497978 2:166230824-166230846 CTAAAAAATGTGAGTAATGATGG + Intronic
941782810 2:169463165-169463187 CTCAAAAAGGAGAATAGTGAAGG + Intergenic
942076451 2:172360670-172360692 TTGAACCATGAGACTTCTGAGGG - Intergenic
943277298 2:185883541-185883563 CTCAATAATGAGAGTATTGAGGG + Intergenic
944556373 2:200891438-200891460 CAGAATTATGAGAATACTGAGGG + Intronic
945015089 2:205506942-205506964 ATGAAAAAAGAGACTCCTAATGG - Intronic
945052771 2:205840912-205840934 CACAAAAATGAGACTAATAAAGG + Intergenic
945448976 2:209971947-209971969 ATGAAAAATTAGAATACTTATGG - Intronic
946646404 2:221840628-221840650 CTGAAAAAGGAGAGTATTGGTGG - Intergenic
946959917 2:224973738-224973760 CTGTAAAATGAGAGTCGTGAGGG - Intronic
947515028 2:230795809-230795831 CTAAAAAATGAGACTATTTTGGG - Intronic
1171172395 20:23027168-23027190 TTGCCAAGTGAGACTACTGAGGG + Intergenic
1171558303 20:26097621-26097643 CTGCAAAATGAAACTATAGAAGG + Intergenic
1171765812 20:29273785-29273807 CTGAAAACTGATATTTCTGAAGG - Intergenic
1172589769 20:36109368-36109390 CTGCAAACTGAGACTAATGGTGG + Intronic
1172707480 20:36892676-36892698 CTAAGAAAATAGACTACTGAAGG + Exonic
1173302783 20:41818597-41818619 CTGTAAAATGGGAGTAATGATGG + Intergenic
1173499932 20:43545779-43545801 CTGAAAACTGGCACTTCTGATGG - Intronic
1174544188 20:51313104-51313126 CTGCAAAGTGAGACCACTAAAGG + Intergenic
1174740123 20:53004872-53004894 CTGTAAAATGGGAATAATGATGG - Intronic
1174994688 20:55552799-55552821 CTGAAGAATGTGACTAAGGAAGG - Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1178897878 21:36575395-36575417 CTGTAAAATGGGAATAATGATGG - Intronic
1179240741 21:39589021-39589043 CAGAAAAATGAAACTACAAATGG + Intronic
1181858693 22:25801470-25801492 CTGTAAAATGGGGCTAATGATGG + Intronic
1182435694 22:30328235-30328257 CTGTAAAATGGGACTAATAATGG - Intergenic
1183247776 22:36707134-36707156 CTGTAAAATGGGAATAATGATGG - Intergenic
1183727995 22:39600113-39600135 CTGTAAAATGGGACTACCCATGG + Intronic
1183760132 22:39808861-39808883 CAGATAAATGAGACTACTAAAGG - Intronic
1184579110 22:45401327-45401349 CTGAAAAATTAGGCTACAAATGG + Intronic
1185106790 22:48875478-48875500 CTAAAAACTGAGACTAATCAGGG + Intergenic
949220955 3:1633246-1633268 CTAAATAAAGAGATTACTGAGGG + Intergenic
951113555 3:18833782-18833804 CTGAGAAAAGATACTCCTGAAGG + Intergenic
951151639 3:19297608-19297630 CTCAAACCTGAGTCTACTGAAGG + Intronic
951829562 3:26910650-26910672 CTGAAAAATGAAAATAATAAAGG - Intergenic
952049617 3:29368535-29368557 CTGAAAAATGAGAGTTCACAAGG + Intronic
952324474 3:32308604-32308626 CTGTAAAATGGGACTAATTATGG + Intronic
952341035 3:32447567-32447589 GTGAAAAATGAGAAAAATGAAGG - Intronic
953579164 3:44137780-44137802 CTGTAAAATGAGGATACTGATGG - Intergenic
953706384 3:45234188-45234210 CTGTAAAATGAGAATAATAATGG + Intergenic
954133633 3:48572211-48572233 CAGAAAGATGAGACTCCGGAGGG + Intronic
954793213 3:53147893-53147915 CTGTAAAATGGGACTAATGATGG + Intergenic
955322823 3:57986436-57986458 CTGTAAAATGGGACTAATAAAGG - Intergenic
956023139 3:64953588-64953610 CTCAAAGATGAGACTACTTCTGG + Intergenic
956144270 3:66176570-66176592 CTAAAAATTGAGACTATTGAGGG + Intronic
956357161 3:68406579-68406601 CTCAGAAATGAAACAACTGAAGG - Intronic
957126691 3:76170658-76170680 TTGAAAAATGAGAATAGTAATGG + Intronic
957589993 3:82184350-82184372 CTGAAAAATCAGTAAACTGAAGG + Intergenic
957984331 3:87553224-87553246 CATAAAAATGAGACTACAAAGGG - Intergenic
959024249 3:101222012-101222034 CTGAAAACTGAGGTTTCTGATGG + Intergenic
959285980 3:104411936-104411958 CTGAAGAATGAGGCTACAGCTGG - Intergenic
961240882 3:125410302-125410324 CTGAAAATGCAGACTACTGCAGG + Intergenic
962034268 3:131634635-131634657 CTCAAGAATGAGAATATTGAAGG - Intronic
962877732 3:139548657-139548679 CTGATAAATGAGCCTGCAGAAGG + Intergenic
966201917 3:177366679-177366701 CTCACCAATGAGAATACTGAGGG + Intergenic
966658529 3:182387479-182387501 CTGAGAGATGAGAAAACTGAGGG - Intergenic
967319039 3:188177641-188177663 CTGTAAAATGGGAGTAATGATGG + Intronic
970063179 4:12059332-12059354 CAAAACTATGAGACTACTGAAGG - Intergenic
972139258 4:35936491-35936513 CTGTAAAATGGGAATAATGATGG + Intergenic
972189566 4:36573970-36573992 CTGAGAAATGAGACTAAGCATGG + Intergenic
972641069 4:40925361-40925383 CTGCAAAATGAGGGTAATGATGG - Intronic
972708208 4:41566496-41566518 ATGAAATATCAGAATACTGAAGG + Intronic
974332321 4:60496765-60496787 CTGAGAACTCAGACAACTGATGG + Intergenic
975502808 4:75105723-75105745 CTGAAAAAATAGACTACACAAGG - Intergenic
975608113 4:76176509-76176531 CAGAAAAATGGGACTAATGATGG - Exonic
976455709 4:85244918-85244940 CTGAAAAATTAGCTTACTCAAGG + Intergenic
977143212 4:93401898-93401920 CCAAAAAGTGAGACTAATGATGG - Intronic
978789557 4:112646386-112646408 ATGAAAAAATTGACTACTGATGG + Exonic
978843708 4:113246885-113246907 TTGAGAAATGAGACTACCAAAGG + Intronic
980857497 4:138456703-138456725 CTGAATAATGAGAACACCGAGGG + Intergenic
982943989 4:161594922-161594944 CTGCAAAATGGGATTAATGATGG - Intronic
984425182 4:179574197-179574219 ATGAGATATGACACTACTGAAGG + Intergenic
985870560 5:2551418-2551440 CTGACACATGAGAATACCGATGG + Intergenic
986505958 5:8451598-8451620 CTGAAGAATGGGGCTGCTGAAGG - Intergenic
987163701 5:15172043-15172065 CTGAAAAATCAGACTTCCCATGG + Intergenic
988564344 5:32309055-32309077 CTGAAAAATGTGACCACTTCAGG + Intronic
990531752 5:56681090-56681112 CTGAAAAATGGAATTACAGAGGG + Intergenic
991239517 5:64441457-64441479 CTGAACAAGGTGACTACTGTCGG + Intergenic
992357897 5:76004389-76004411 TTGTAAAATGAGACTAATAATGG + Intergenic
992442775 5:76811399-76811421 CTGAAAAATGATACTGCTCTAGG - Intergenic
993650441 5:90514193-90514215 CAGAAAAATGAGACTCATGCTGG - Exonic
995313547 5:110739874-110739896 CTTAAAGATGAGAAAACTGAGGG - Intronic
995528033 5:113066418-113066440 CTGAAAAATGAGGTTTCTAATGG + Intronic
998817224 5:146026826-146026848 CTGTAAAATGGGACTAATGATGG + Intronic
999372482 5:151064303-151064325 CTAAAACATGAGACTAGAGAAGG + Intronic
1000166651 5:158656187-158656209 CAGAAAAATTAGACTTATGAGGG + Intergenic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1000865072 5:166503518-166503540 CTTAAAAATGAGATTACTGAGGG - Intergenic
1001070931 5:168584513-168584535 CTGCAAAATGAGATGACTGTTGG + Intergenic
1001719413 5:173844296-173844318 CTGAAAAAAGAGAATGCTGAGGG + Intergenic
1001804150 5:174569125-174569147 ATGAAGAATGAGGCTACTGTTGG - Intergenic
1003937407 6:10989754-10989776 CTGGAAGATGAGACAACCGAAGG + Exonic
1004450556 6:15741392-15741414 CTGTAAAAGGAGATTACTAATGG + Intergenic
1005316550 6:24608469-24608491 TTGAAAAATGAGATAATTGAGGG + Intronic
1005449941 6:25962764-25962786 CTGAGAAGTGAAACTACTGTGGG - Intergenic
1005596484 6:27383165-27383187 CTGAAAAAAGAGAATATTTAAGG + Intronic
1005792391 6:29317589-29317611 ATGAAAAATCAGGCTACAGAAGG - Intergenic
1006216342 6:32446476-32446498 CAGAATCTTGAGACTACTGATGG + Intergenic
1006660911 6:35643461-35643483 ATGAAAAATGACCCTACAGAAGG - Intronic
1007277095 6:40682430-40682452 CTGAAAAAGGAGAATATTGTAGG - Intergenic
1007730666 6:43943552-43943574 CTGTAAAATGGGACTAATAATGG + Intergenic
1008171929 6:48218419-48218441 CTGAAAAATCAAAGTCCTGAGGG + Intergenic
1011002583 6:82607586-82607608 CTGTAAAATGGGAATAATGATGG - Intergenic
1011035419 6:82968924-82968946 CTAATAATTGAGGCTACTGATGG - Intronic
1012238011 6:96839667-96839689 CAGAAGAATGAGAATGCTGATGG + Intergenic
1012739414 6:102996090-102996112 CTGAAGAATAAGTATACTGAAGG + Intergenic
1013417236 6:109935988-109936010 CTGTTAGCTGAGACTACTGAGGG + Intergenic
1014575138 6:123059991-123060013 CTGAAAAATGAGATTAAGAAAGG + Intronic
1014845923 6:126276994-126277016 CTGAAAAATGTGACTCCTTCAGG + Intergenic
1014932696 6:127352533-127352555 CTTAAACAAGACACTACTGATGG + Intergenic
1017691088 6:156965641-156965663 CTGGAAAAAGAGGCTACTAATGG - Intronic
1017809534 6:157974876-157974898 GTGAAAAATGAAACAAGTGAGGG - Intergenic
1018716233 6:166534673-166534695 CTTAAAGATGAGATGACTGATGG + Intronic
1021168461 7:17369318-17369340 CTCGAAACTGAGCCTACTGAAGG - Intergenic
1021239878 7:18187284-18187306 CTTATAAATGAGGATACTGAGGG + Intronic
1021413933 7:20360110-20360132 CTGAAATATGAGATTAGAGATGG + Intronic
1021703204 7:23340765-23340787 CAGAAATAGGAGACTAGTGATGG - Intronic
1024373511 7:48612431-48612453 CTCAAAAATGAAATTAATGATGG - Intronic
1025092332 7:56074417-56074439 CAGAAAAAAGAGACTACAGGAGG - Intronic
1025265615 7:57454464-57454486 CTGCAAAAGGAGATTATTGAAGG + Intronic
1025564076 7:62409005-62409027 GTGAAAAATGATACTATTTAAGG - Intergenic
1025626045 7:63223285-63223307 CTGAAAAATGAGTCTATAAATGG + Intergenic
1025833889 7:65078046-65078068 CTGAAAAATGAGGATACCTATGG - Intergenic
1025903661 7:65767561-65767583 CTGAAAAATGAGGATACCTATGG - Intergenic
1027765157 7:82331148-82331170 TTGAAAAATGAGACTAATAATGG + Intronic
1030016048 7:105222637-105222659 CTCAAAAATGTAACTAATGATGG - Intronic
1030492049 7:110249546-110249568 ATGATGAATGAGACTACTGAAGG - Intergenic
1030823543 7:114125588-114125610 CTGAAAGATTAGTCTTCTGAGGG - Intronic
1030862302 7:114649447-114649469 CTGAAAAATGAGAGGATTGGTGG - Intronic
1031852982 7:126888147-126888169 CTGACAAATGACACTCCTCAGGG + Intronic
1033680982 7:143596345-143596367 CTGAACAATGAGACTACATGAGG - Intergenic
1033703910 7:143865468-143865490 CTGAACAATGAGACTACATGAGG + Intronic
1036011852 8:4734774-4734796 CTTAAAAATGAGAGTAAAGATGG - Intronic
1037027650 8:14059022-14059044 CTTGAAAATGAGATAACTGAAGG - Intergenic
1037384516 8:18323601-18323623 AGGAAAAATGAGACTAGGGAAGG - Intergenic
1043649395 8:82570599-82570621 CTGAAAAAAATGCCTACTGATGG + Intergenic
1044095041 8:88052896-88052918 GTGAGAAATGAGACTCCTGGTGG - Intronic
1046001989 8:108432544-108432566 CTGGAAAGTGAGACTAGGGAGGG + Intronic
1046605078 8:116362359-116362381 CTTGAAAATGAGACAACTGTGGG + Intergenic
1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG + Intronic
1050340564 9:4633607-4633629 CTGAAGAAACAGACTACTAAGGG + Intronic
1051436717 9:17041553-17041575 TTGAGAACTGAGACTATTGAGGG - Intergenic
1051696927 9:19778413-19778435 CTGTAAGCTGAGACTCCTGAAGG + Intronic
1052212906 9:25928688-25928710 CTGTGCAATGAGTCTACTGATGG + Intergenic
1055432101 9:76254615-76254637 TTGAAAAATGACACTAAAGAAGG - Intronic
1056693022 9:88823977-88823999 TTGAAAAATGAGGCTAGGGAGGG + Intergenic
1057436971 9:95049449-95049471 CAGATAAATGGGAATACTGAGGG + Intronic
1058364619 9:104193992-104194014 CTGAATAATGAGACTGGTGGTGG + Intergenic
1059888825 9:118778139-118778161 CAGATACATGAGACTAGTGAAGG + Intergenic
1059974763 9:119703764-119703786 CTGAAAAATCAGACTCATGCAGG - Intergenic
1060766697 9:126299340-126299362 CTTTAAAATGGGACTAATGATGG + Intergenic
1062054143 9:134462264-134462286 CTGTAAAATGAGAGTATTGATGG + Intergenic
1186623355 X:11264879-11264901 CTGAAATATGGGAATAATGATGG - Intronic
1186954462 X:14666762-14666784 CTGAAAAATGAGGATAATAATGG - Intronic
1187223652 X:17354891-17354913 GTGTAAAATGAGACTAATAATGG - Intergenic
1187691790 X:21876066-21876088 CTGATCAAAGAGAATACTGAGGG + Intronic
1188093492 X:25992365-25992387 GTGAAAAATGAAACAACTTATGG + Intergenic
1189459912 X:41231789-41231811 CAGAAAAATGAGAGCACTGTAGG + Intronic
1189675539 X:43457037-43457059 GGGAAAAATGAGCCTTCTGAGGG - Intergenic
1189874842 X:45425216-45425238 CTGAAAAATAATACTATAGATGG + Intergenic
1189962640 X:46338977-46338999 CAGAAAACTGACACTGCTGATGG + Intergenic
1191991896 X:67046802-67046824 CTGAAAAATGGGAATACTAGTGG + Intergenic
1192192126 X:68997321-68997343 CTGTAAAGTGAGGCTAATGATGG + Intergenic
1193762336 X:85482917-85482939 TTGAAAATAGATACTACTGATGG - Intergenic
1193927763 X:87509875-87509897 TTGAAAAATGAGAATACGGTTGG - Intergenic
1193965604 X:87982307-87982329 CTGAAATAGGTGACTACTAAGGG + Intergenic
1195006670 X:100691941-100691963 GTGAAAAATGAGACTGGAGAGGG - Intronic
1195714687 X:107807376-107807398 CTAAAAAATGAGACCAATAAAGG - Intergenic
1197226098 X:123958057-123958079 ATGAAAAATGAAATAACTGATGG - Intergenic
1201061892 Y:10053457-10053479 CTGAAAAAGGAGTCAGCTGAGGG + Intergenic
1201417563 Y:13762495-13762517 TAGAAAAATGAAAATACTGATGG - Intergenic