ID: 924367714

View in Genome Browser
Species Human (GRCh38)
Location 1:243313571-243313593
Sequence CAGGGTTAACACAGTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924367710_924367714 13 Left 924367710 1:243313535-243313557 CCTCAGCTGCTCTTTCATCTGGA 0: 1
1: 0
2: 1
3: 24
4: 287
Right 924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924367714 Original CRISPR CAGGGTTAACACAGTGTTGC TGG Intronic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
901386666 1:8913988-8914010 GAGGGAGAACCCAGTGTTGCTGG + Intergenic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
906691193 1:47793744-47793766 CAGTGTAAACATAGTGTTACTGG + Intronic
910078985 1:83316570-83316592 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
911234737 1:95400008-95400030 CAGAGTCCACACAGTGTTGGAGG + Intergenic
913546406 1:119872956-119872978 CAGGGTTGTCAGAGTGTTCCAGG + Intergenic
916058072 1:161081630-161081652 CAGGGACAACACACTGTTGGGGG - Intronic
921193050 1:212726662-212726684 CAGGGGTAACACAGTGCCGCTGG - Intronic
922868799 1:228883589-228883611 CAGGGTTAGCACCATGGTGCTGG - Intergenic
923459912 1:234200014-234200036 CAGGGACAACACACTGTTGGTGG + Intronic
924197844 1:241626959-241626981 CAGGGTTGACAAAGTGTAGCAGG - Intronic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
924732910 1:246728458-246728480 CATGAGTAACACAGTGTGGCTGG + Intronic
1063189073 10:3677059-3677081 CAGGGTTTGCCCAGTGTTTCTGG + Intergenic
1065282959 10:24158825-24158847 CAGAGTTAGCAGAGTGCTGCTGG + Intronic
1067799837 10:49351338-49351360 CAGGCTTCAGGCAGTGTTGCGGG + Intergenic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1076525330 10:131109049-131109071 CAGGATGAGCACAGTGTTGTGGG + Intronic
1077756040 11:5028658-5028680 CATGGTTAAGACAGTGTTAAGGG + Intergenic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1087092586 11:94288959-94288981 AAGGGTTAAGACAGAGTTGTTGG + Intergenic
1089761354 11:120726432-120726454 CAGGGTAAAAGCAGTGTTGATGG + Intronic
1090223766 11:125055739-125055761 CCTGGTTCACACAGTGATGCTGG - Intergenic
1094455190 12:30624179-30624201 GAGGATTAACACAGTGTGGTGGG + Intergenic
1102826179 12:115949623-115949645 CACTGATAACACAGTGTTGTCGG + Intergenic
1105317936 13:19285296-19285318 CATAGTTAAAACACTGTTGCTGG - Intergenic
1107727597 13:43315580-43315602 CAAAATTAACACAGTGTTGTTGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1115640408 14:35332212-35332234 CAGAGTTAACACAGTGGTTTAGG + Intergenic
1118613017 14:67555981-67556003 CAGGTATAACACAGTACTGCTGG - Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1128635967 15:69302625-69302647 CAGGGGTCACACAGGGTTCCTGG - Intronic
1129310169 15:74701983-74702005 CAATGTTAACACACTATTGCTGG - Intergenic
1130388794 15:83436523-83436545 CAAGGTGATGACAGTGTTGCTGG - Intergenic
1131986031 15:98043625-98043647 CTGGGTAAACTCAGTGATGCCGG + Intergenic
1132132546 15:99296259-99296281 CAGGGCTGACCCAGTGTTCCTGG - Intronic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1142211571 16:88811098-88811120 CAGGGAGAACAGAGTGTTCCTGG - Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1148236722 17:45974124-45974146 CAGCGTTTACACAGGGCTGCCGG + Intronic
1155442724 18:25878974-25878996 GAGGATTAATACAGTTTTGCAGG - Intergenic
1157247867 18:46070331-46070353 CAGGGTGAAGACAGGGTTCCAGG - Intronic
1160421010 18:78744280-78744302 CAGTGTTCACACAGTGGTGAAGG + Intergenic
1160770733 19:829568-829590 CGGGGTTAGCACCGTGGTGCTGG + Exonic
1163400100 19:17086955-17086977 CAGTGTTAGCACAGTTATGCTGG + Intronic
1166686542 19:44800084-44800106 CAGGGGTGACACAGTGGTGGCGG - Intronic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
934626920 2:95867123-95867145 GAGGGTTATCACAGTATTTCAGG + Intronic
934806638 2:97234167-97234189 GAGGGTTATCACAGTATTTCAGG - Intronic
934830871 2:97523008-97523030 GAGGGTTATCACAGTATTTCAGG + Intronic
935668364 2:105534250-105534272 CAGGATTAACTGAGTGTTGTAGG - Intergenic
936454029 2:112657053-112657075 GAGGGTTTACACAATATTGCAGG + Intronic
937727514 2:125185647-125185669 CAGGGTAAACAAGGTGTTGTAGG + Intergenic
938371503 2:130771503-130771525 CAATGTTGACACATTGTTGCAGG + Intergenic
938743933 2:134259494-134259516 CAGGGTTAACAACGTGTGGATGG - Intronic
943072770 2:183161165-183161187 CAGAGTTAGCAGAGTGCTGCTGG + Exonic
948869288 2:240790188-240790210 CTGGGTTCAGACAGTGTTCCAGG - Intronic
1169120706 20:3093937-3093959 AAGGCTTAAAACAGTGATGCTGG - Intergenic
1170077496 20:12435633-12435655 CAGTAATAAAACAGTGTTGCTGG + Intergenic
1172980560 20:38938355-38938377 CAGGGGTAACAGAGTGTGACGGG - Intronic
1173275002 20:41572695-41572717 CAGAGTTAATACACAGTTGCTGG - Intronic
1173744758 20:45427670-45427692 CAGTCTTAACACAGTGGTACAGG + Intergenic
1174358253 20:50012330-50012352 CAGGGGTAAGAAAGTGTTCCAGG - Intergenic
1177264766 21:18768055-18768077 CAGGCTTAACAAAGGGTTACAGG + Intergenic
1178731475 21:35106884-35106906 CAGGACTAACGCAGTGTTACTGG + Intronic
1179009930 21:37548640-37548662 CAGTTTTATCACCGTGTTGCAGG - Intergenic
1181323533 22:22026545-22026567 CAGTGCTCACACAGTGCTGCAGG + Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184631641 22:45785678-45785700 CAGGCTTAACTCAGTGCTCCTGG + Intronic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
951781492 3:26368288-26368310 TAGAGTTAACACGTTGTTGCAGG + Intergenic
958752111 3:98203806-98203828 CAGGGATAAGGCAGTGTAGCAGG + Intergenic
970386333 4:15560738-15560760 CAGGTTTAACACATTATTCCTGG - Intronic
971081014 4:23211239-23211261 CAGTGTTCACACAGTGATGAAGG - Intergenic
972278942 4:37585083-37585105 CAGGATAAACAAAGTATTGCAGG + Intronic
975378608 4:73672835-73672857 CACTGGTAACACAGTGTTGGTGG - Intergenic
976554153 4:86431551-86431573 TTGGCTTAACCCAGTGTTGCAGG + Intronic
979463988 4:121015587-121015609 CAGGGGTAACACAGGCGTGCTGG + Intergenic
982174680 4:152694558-152694580 CAGGGTTAACATCTTTTTGCTGG + Intronic
982242999 4:153319425-153319447 CAGGGTTAAAATATTTTTGCTGG + Intronic
982309995 4:153974745-153974767 CAGGCTTAACACCGTGTGGAAGG - Intergenic
982404662 4:155006341-155006363 CTGGGGAAACACAGTGTTGTAGG + Intergenic
982447479 4:155510272-155510294 GAGGTTTTACACAGTGTTACTGG + Intergenic
984843813 4:184093167-184093189 CTGGGTATACACAGTGTTCCAGG - Intronic
986680621 5:10229921-10229943 CAGGCTTAACAAAATGTTCCTGG + Intronic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
990353255 5:54939714-54939736 CAGGGTTAGAACAGTTTTCCTGG + Intergenic
990549948 5:56864817-56864839 CCGTGTTAACAAAGTGATGCGGG + Exonic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
994221256 5:97197904-97197926 CATGGTTAGGAGAGTGTTGCTGG + Intergenic
994266993 5:97729184-97729206 CATTCTTAACACAGTGTTGTTGG - Intergenic
994580505 5:101635286-101635308 CAGTGATAACACAGTGCTGTGGG - Intergenic
997165934 5:131660176-131660198 CAGGGTGGACACAGTCTTGGTGG + Intronic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
998953566 5:147415559-147415581 TAGGGATAACACAATGTTCCAGG - Intronic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1013418234 6:109943706-109943728 CTGGGTTTACAAAGTGCTGCAGG + Intergenic
1013439589 6:110149376-110149398 CAGGGTAAACACAATATTCCTGG + Intronic
1013692140 6:112658283-112658305 CTGGGTTAACACAGAATTCCTGG - Intergenic
1014634485 6:123828332-123828354 GTCAGTTAACACAGTGTTGCTGG - Intronic
1014676815 6:124377985-124378007 CAGGGTTGACACAATGTGGCAGG - Intronic
1015161862 6:130161500-130161522 TGGGATTAACACAGTGTTGGTGG + Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1020731516 7:11887283-11887305 AAGGGACAACACAGTGTTGAAGG - Intergenic
1024528997 7:50375015-50375037 CAGGCTCAACCCAGAGTTGCAGG - Intronic
1026445343 7:70479793-70479815 TAGGGTTAGCACAGTGGTGAGGG - Intronic
1027296758 7:76781844-76781866 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
1028108297 7:86906474-86906496 CAGGGGTAACACAGTATTTTGGG - Intronic
1034359626 7:150482928-150482950 CAAGGTTACCACAGAGTTGGGGG - Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1039614144 8:38941555-38941577 CAGGTTTCATACAGTTTTGCAGG + Intronic
1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG + Intronic
1044309189 8:90673920-90673942 AAGAGTTACAACAGTGTTGCTGG + Intronic
1048910980 8:139134823-139134845 CAGGGTTCACACAGGTTTGCAGG + Intergenic
1050429982 9:5552483-5552505 CAGGGCTATCCCAGTGCTGCAGG - Intronic
1051995541 9:23211916-23211938 TGGGGTTAACACATTTTTGCAGG - Intergenic
1053321664 9:37104309-37104331 GAGGGGTAACACAGTTTTGGTGG - Intergenic
1060057343 9:120426140-120426162 CATGGTTAACAGAGTGATGCAGG - Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1186126806 X:6423109-6423131 CATGGTTAAGACTGTGTTGGTGG - Intergenic
1190194617 X:48306432-48306454 CAGTGGCAACAAAGTGTTGCTGG - Intergenic
1190661114 X:52655034-52655056 CAGTGGCAACAAAGTGTTGCTGG - Intronic
1195703416 X:107721752-107721774 GAGCGTTAACACAGTGTTAATGG + Intronic
1198506476 X:137306445-137306467 CAGAGTTGACAGAGTGTTGAAGG - Intergenic
1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG + Intergenic
1200855924 Y:7938130-7938152 CAGGGCTAAGACAGTGTAGAAGG + Intergenic