ID: 924371587

View in Genome Browser
Species Human (GRCh38)
Location 1:243356668-243356690
Sequence CGACAATCAGCAGTGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924371587_924371589 1 Left 924371587 1:243356668-243356690 CCTACAACCACTGCTGATTGTCG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 924371589 1:243356692-243356714 AAATAACTTCATGCTAGACATGG 0: 1
1: 0
2: 2
3: 23
4: 257
924371587_924371590 4 Left 924371587 1:243356668-243356690 CCTACAACCACTGCTGATTGTCG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 924371590 1:243356695-243356717 TAACTTCATGCTAGACATGGTGG 0: 1
1: 0
2: 5
3: 20
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924371587 Original CRISPR CGACAATCAGCAGTGGTTGT AGG (reversed) Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910940381 1:92526662-92526684 AGACAGTAAGCAGTGGTTGCAGG + Intronic
913031393 1:114907263-114907285 CTCCAATTAGCAGTGATTGTCGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
919232827 1:194797278-194797300 CAAGAATCAGCAGTGGATGTTGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921348506 1:214211733-214211755 AGAAAATCAGCAGTGGGGGTCGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924371587 1:243356668-243356690 CGACAATCAGCAGTGGTTGTAGG - Intronic
1064003060 10:11679434-11679456 CGACAAACCGCAGTGCATGTTGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070583391 10:77742037-77742059 GGCCACTCAGCAGTGGTGGTAGG + Intergenic
1070607072 10:77906250-77906272 TGCCTATCAGCAGTGGGTGTGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076307952 10:129477999-129478021 CCAGAAACATCAGTGGTTGTGGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077925825 11:6681432-6681454 AGACATTCAGCAGAGGATGTTGG - Exonic
1081063030 11:38503995-38504017 CCACAATCAGCAGTGGGGGATGG - Intergenic
1081657836 11:44868971-44868993 CACAAATCAGCAGTGATTGTGGG - Intronic
1082039912 11:47676344-47676366 AGAGTAGCAGCAGTGGTTGTGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1088853925 11:113729233-113729255 CAACAATCTGCTGTGTTTGTGGG + Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1107406210 13:40116230-40116252 CGTCAATCAGCAAGGGTTGGCGG - Intergenic
1109066261 13:57696910-57696932 TGTCAATCAGCTGTGGATGTGGG - Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111849841 13:93559017-93559039 AAACATTCAGCAGTGGTTGTGGG + Intronic
1113239195 13:108317271-108317293 AGGTAATCAGCAGTGTTTGTTGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1118322253 14:64760016-64760038 GGACAAGCAGCATTGGTTGCTGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130025541 15:80267769-80267791 AGGACATCAGCAGTGGTTGTGGG - Intergenic
1130951297 15:88591312-88591334 CTAGAATTAGCAGTGGTGGTTGG - Intergenic
1131313226 15:91309654-91309676 TGTCAATCAGCACTGGATGTGGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133483925 16:6199990-6200012 GGACAATGAGCAGGGGTTGATGG + Intronic
1133609084 16:7416431-7416453 TAACAATCAGCAGAGGTTGGGGG - Intronic
1135587441 16:23681542-23681564 AGACCATCAGCAGCGGTTGGTGG + Intronic
1136674482 16:31890415-31890437 CAAAAATCAGGAGTGGTTGTTGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143006672 17:3840681-3840703 AGACAATGTGAAGTGGTTGTAGG - Intronic
1144292548 17:13840600-13840622 ACACAATCAACAGAGGTTGTGGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157979280 18:52362408-52362430 CGACCACCAGCATTGGTTGGTGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1162454651 19:10776050-10776072 CGAGAACCAGCAGTGCTGGTGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
928316674 2:30251891-30251913 CGACCAACAGCAGAGGCTGTTGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929365787 2:41154865-41154887 CGACAAGCAGCAGAGGCGGTGGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933856852 2:86422607-86422629 CCACAATCAGCTGTGCTTCTGGG - Intergenic
938436699 2:131287402-131287424 AAACAATCAGCAGTGCTTCTGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1169921585 20:10740021-10740043 CTAAAGTCAGCAGTGATTGTTGG + Intergenic
1171440229 20:25154757-25154779 CGAAAATCAGCAGTGCGTGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174436150 20:50508524-50508546 CGAGAATCAGCTGGAGTTGTTGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
952509146 3:34036508-34036530 CCACAATCAGAAGTAGTTTTGGG + Intergenic
952527271 3:34223799-34223821 CCAAAATCAGCAGTGTTCGTTGG - Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
959540992 3:107538638-107538660 CTTCAATTAGCAGTGGCTGTTGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962365419 3:134775873-134775895 TGTCAATCAGCTGTGGATGTGGG + Intronic
962456897 3:135573135-135573157 GGACAATGAGCAGTGGGTGTTGG + Intergenic
965762619 3:172095388-172095410 CGCCAATGGGCAGTGGTGGTGGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972388624 4:38591777-38591799 TGACAAGAAGCAGAGGTTGTGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972956608 4:44400232-44400254 AAACACTCAGCAGTTGTTGTTGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984581919 4:181519840-181519862 CCACAATAAGCAGAGGCTGTTGG + Intergenic
985358230 4:189144123-189144145 CCACACTCAGCAGTGGGTCTAGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990750373 5:59009563-59009585 GGACAATCAGCACTGGACGTGGG + Intronic
991915601 5:71601819-71601841 CCCCAACCAGCTGTGGTTGTTGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1003936788 6:10983186-10983208 TTAGAATCAGGAGTGGTTGTGGG + Exonic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008024021 6:46613312-46613334 AGCCAATCAACAGTGGTTTTTGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008698416 6:54069046-54069068 GGACAATCAGCACTAGCTGTGGG - Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1026207714 7:68272628-68272650 GGACTCTCAGCAGTGGCTGTAGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028266592 7:88733666-88733688 AAATAATCAGCAGTGGTAGTCGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036766273 8:11551162-11551184 TGTCACTCAGCAGTGTTTGTGGG + Intronic
1037912776 8:22753915-22753937 GTAGAATCAGCAGAGGTTGTGGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039626373 8:39058892-39058914 GGAAAATCAGCATTGGATGTTGG + Intronic
1045397620 8:101776578-101776600 CAACAAGCAGCAGAGCTTGTTGG + Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048214359 8:132481189-132481211 AGACAATCAGCGGTGGGGGTCGG - Intergenic
1053219139 9:36297155-36297177 CCACTATCTGCAGTGCTTGTTGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058487297 9:105454848-105454870 AGACAATCAGAATTGATTGTAGG + Intronic
1058890286 9:109355399-109355421 GGCCAATCAGCAGTAGCTGTGGG + Intergenic
1062137958 9:134939586-134939608 ATTCATTCAGCAGTGGTTGTGGG - Intergenic
1062255019 9:135616744-135616766 CAACACTCAGAAGGGGTTGTCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200941260 Y:8784135-8784157 CAACAACCAGCCGTGGTTGATGG - Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic