ID: 924372240

View in Genome Browser
Species Human (GRCh38)
Location 1:243363145-243363167
Sequence ACAAGGAAGCTGCAGGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924372240 Original CRISPR ACAAGGAAGCTGCAGGTCAT AGG (reversed) Intronic
900555156 1:3276613-3276635 CCAGGGAAGCTGCAGGGCCTTGG + Intronic
900593921 1:3471923-3471945 ACGAGGACCCAGCAGGTCATGGG - Intronic
901342586 1:8508877-8508899 GAAAGGAAGCTGCAGTTCTTAGG - Intronic
901650172 1:10738544-10738566 ACAAGGAGGCTGCAGGGCCATGG + Intronic
902164470 1:14559077-14559099 AAAAGGAAGCTCCAGTTTATAGG - Intergenic
902517948 1:16999976-16999998 GGAAGGAAGCTGCAGGCCAGGGG + Intronic
903008634 1:20315055-20315077 ACAAGGAAGGAGAAGTTCATTGG + Intronic
903580034 1:24364030-24364052 AAACGGAAGCAGCAGGACATGGG - Intronic
904013600 1:27404299-27404321 ACATGGAACCTTCAGGTCAGTGG + Exonic
904108339 1:28105201-28105223 ACTAGGAAGCTGCAGCTCGCTGG - Intergenic
904752589 1:32750168-32750190 CCAAGGAAGCTGCAGGGACTTGG - Intronic
906677996 1:47707625-47707647 ACACAGCAGCTGCAGGTCGTGGG + Intergenic
906709225 1:47916681-47916703 TTAGGGAAGCTGCAGGACATGGG + Intronic
906833953 1:49062576-49062598 AAAAGGAAGGTGGAGGCCATAGG + Intronic
907229809 1:52985880-52985902 ACAAGGAAGATGGAGGTGAGTGG - Intronic
907235582 1:53043490-53043512 AAAAGGAAGCTGTAGAGCATAGG + Intronic
915367967 1:155325896-155325918 TCCAGGAAGATGCAGGTCAGAGG + Exonic
915897767 1:159824848-159824870 ACTGGGAAGCTGCCTGTCATGGG - Intergenic
921752957 1:218818638-218818660 GCAAGGAAGCAGCAGCTCAGTGG + Intergenic
922532703 1:226356597-226356619 AAAAGGAAGCTCCAGGTAAGAGG - Intergenic
922768010 1:228166040-228166062 ACTCGGAAGCGGCAGTTCATTGG - Exonic
923072122 1:230575419-230575441 ACATGGATGCTGCTGGTCACTGG - Intergenic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1065308848 10:24395021-24395043 ACATGGATGCTGCAGGTCAGGGG + Intronic
1066622071 10:37366464-37366486 AGAAGGAAGCTGCATCTCAGGGG + Intronic
1070702839 10:78616029-78616051 AGAAGGAAACTGCAGGCCACAGG - Intergenic
1072198563 10:93138298-93138320 ACACGGATGCTGCAGGCCGTGGG + Intergenic
1074770942 10:116733355-116733377 ACAGGGAAGCTGTAGGTATTCGG - Intronic
1075729379 10:124627262-124627284 ACAGGGCAGCTGCAGGGCCTGGG - Intronic
1075749804 10:124757081-124757103 ACAATCAAGCTCTAGGTCATGGG + Intronic
1078038796 11:7837649-7837671 ACGATGAAGCTTTAGGTCATAGG + Intergenic
1081117833 11:39226657-39226679 AAAAGTAAGGTGCAGGTTATTGG + Intergenic
1081783510 11:45730085-45730107 ACAGGGAAGCTGATGGTCAGAGG + Intergenic
1086993047 11:93327116-93327138 ACAGGGAAGCTGGAGAACATGGG - Intergenic
1088684190 11:112271336-112271358 ACAAGGAAGACACAGGACATGGG - Intergenic
1091074846 11:132605908-132605930 GAAAGGAAGCTGCTGGTCACTGG - Intronic
1093194487 12:16113401-16113423 ACAGGAAAGCTGCAGGTTAAGGG - Intergenic
1094562922 12:31572338-31572360 ACAATGAAGCTGTAGGACTTTGG - Intronic
1095724211 12:45434316-45434338 AAGAGGAAGCTGCAGGTAAGAGG + Intronic
1098227968 12:68344353-68344375 CCAAGTATGCTGCAGGTCGTTGG - Intergenic
1102741450 12:115211105-115211127 AGAAGGAGGCTGCAGGACAGGGG + Intergenic
1103447172 12:121001881-121001903 ACAGGAAAGCTGGAGGTCATGGG - Exonic
1103852003 12:123939393-123939415 ACAAGCTCGCTGCAGGTGATGGG + Intronic
1104227960 12:126855042-126855064 CCAAGGCAGCTGGAGCTCATAGG + Intergenic
1105024798 12:132840724-132840746 ACAAGGGAGCAGCACGTCCTGGG + Intronic
1105024814 12:132840787-132840809 ACAAGGGAGCAGCATGTCCTGGG + Intronic
1109859006 13:68172419-68172441 AAAAGGAAGATGGAGGTCATGGG - Intergenic
1110151534 13:72260606-72260628 AAAAAGAAGCTCCAGGTCATGGG + Intergenic
1110801733 13:79704834-79704856 AAAAGTGAGATGCAGGTCATAGG + Intergenic
1111409992 13:87862841-87862863 ACAAGGACTCTGCTGGTTATAGG - Intergenic
1114138306 14:19879964-19879986 GCATGCAACCTGCAGGTCATGGG - Intergenic
1115400852 14:32958308-32958330 ACAAGGAAGCTGAATGTAGTTGG - Intronic
1115635750 14:35288869-35288891 ACATGCAGCCTGCAGGTCATGGG - Intronic
1117053072 14:51881530-51881552 TCAGGGAAGCTGAAGGTCCTGGG + Intronic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1118884510 14:69855123-69855145 ATAAGGAAACTGCAGTTCAGAGG - Intronic
1119263886 14:73253223-73253245 ACAGGTAACCTGCAGGTCACAGG + Intronic
1127397446 15:58553870-58553892 AGAGGGAAGCTGAAGATCATAGG - Intronic
1128334573 15:66777822-66777844 CCAAGGAAGCCGCAGGGGATGGG + Intronic
1128742532 15:70093903-70093925 AGAAGGAAGCTGAAGCTCCTGGG - Intronic
1131312217 15:91301121-91301143 AAAAGGAGGGTGCAGGTGATAGG + Exonic
1139151747 16:64390029-64390051 AGAAAGAAACTGCAGGTAATGGG - Intergenic
1140798258 16:78460654-78460676 GCAAGGACACAGCAGGTCATTGG - Intronic
1144949499 17:18986380-18986402 ACAAGGAGGCTGCAGATCCCTGG - Intronic
1145043531 17:19594541-19594563 AAAGGGAAGCTGCCGGTCAGAGG + Intergenic
1146185180 17:30720031-30720053 ATAAGGAAGCTGCAGGCCCCGGG - Intergenic
1146273541 17:31499869-31499891 AAAGAGAAGCTGCAGGTCAGGGG - Intronic
1146506984 17:33414141-33414163 ACAAGGAAGGTACACGCCATAGG + Intronic
1147158549 17:38557940-38557962 ACAGTGAAGCTGCAGGCCACAGG + Intronic
1147753779 17:42754608-42754630 ACAAGGAAACTGAAGCTCAAAGG - Intergenic
1149043636 17:52219685-52219707 TCCAGTAAACTGCAGGTCATTGG - Intergenic
1150584193 17:66502646-66502668 AAAAGAAAGCTGCAGGGCAGGGG - Intronic
1151501815 17:74494882-74494904 ACAATGAGGATGCAGGTCAGGGG - Intergenic
1151528338 17:74686934-74686956 ACAAAGAAGCAACAGGTCACAGG - Intronic
1152038286 17:77886918-77886940 GGGAGGAAGCTGCAGGTCACAGG - Intergenic
1152484164 17:80578854-80578876 AGAAGGAAGCAGGAGGGCATGGG + Intronic
1155070780 18:22314100-22314122 CCAAGGTAGCAGCCGGTCATAGG + Intergenic
1160424739 18:78772177-78772199 AATAGGAAGCTGCAGGGAATAGG + Intergenic
1160424746 18:78772217-78772239 AATAGGAAGCTGCAGGGAATAGG + Intergenic
1160696195 19:485758-485780 ACACAGAAACAGCAGGTCATCGG - Intergenic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1162784507 19:13025819-13025841 AGAAAGATGCTGCAGGTCTTAGG + Intronic
1162973599 19:14195658-14195680 ATAAGGAAGCCGCAGGCCCTGGG + Intronic
1163679756 19:18674212-18674234 ACAAGGAGACTGGAGGTCAGAGG + Intergenic
1164432373 19:28199452-28199474 ACAAGGAAGCTGCGAGGTATGGG + Intergenic
1164744596 19:30601797-30601819 ACAAGCAAACTGCAGGGCTTGGG - Intronic
1164948293 19:32314593-32314615 ACAATGAAGAGGCAGGTGATTGG + Intergenic
1165070323 19:33251678-33251700 ACACGGAGGCAGCAGGTCAGAGG - Intergenic
926006596 2:9377830-9377852 AGGAAGAAGCTGCAGGTCTTGGG - Intronic
927442077 2:23126158-23126180 AGAAGGAAGCTAAAGGTCAAGGG - Intergenic
927913875 2:26921853-26921875 AGAAGTAAGGTGCAGGTCAGGGG + Intronic
928433554 2:31239408-31239430 ACAAGGAAGCAGAAGGCCTTAGG + Intronic
929043678 2:37770879-37770901 ACAAGGAAGCTGGAACTCAGAGG + Intergenic
932288451 2:70555096-70555118 AGAAGGAAGCACCAGGCCATTGG + Intergenic
932795576 2:74692445-74692467 ACAATGGGGCTGAAGGTCATAGG - Intergenic
934724175 2:96604493-96604515 ACAAAGAAGCTGAAGGTTTTTGG - Intronic
935395007 2:102598098-102598120 ACAAGGTAGCCCCAGGTCTTTGG + Intergenic
937059027 2:118967738-118967760 ACACAGGAGCTGCAGGTGATAGG + Intronic
938171387 2:129079798-129079820 ACAAGGAAGCTACAAGTCAAGGG - Intergenic
940154084 2:150635230-150635252 ACAAGCAGGATGCAGGTGATGGG + Intergenic
941327732 2:164138007-164138029 ACAAGGAAGATGAGGGACATAGG + Intergenic
948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG + Intergenic
948793144 2:240389353-240389375 ACTAGGCAGCTCCAGGTCAGGGG - Intergenic
948997741 2:241592321-241592343 ACAGGGAATGTGCAGGTCAGCGG + Intronic
1170472570 20:16682962-16682984 ATGAGGAAGTTGCAGGTTATGGG - Intergenic
1172785121 20:37463746-37463768 AGGAGGAAGCTGCAGTTCAGAGG - Intergenic
1173556116 20:43967071-43967093 AGAAGGATGTTGCAGGTGATTGG + Intronic
1173639635 20:44591679-44591701 ATAAGGAAGCTGAAGCTCATAGG - Intronic
1175484373 20:59334729-59334751 ACAAGGAAGCTTCTGGGCATGGG + Intergenic
1176901866 21:14452086-14452108 ATAAGGAATCTGCAGCTAATAGG + Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1179026190 21:37680734-37680756 TCCAGGAAACTGCAGGTCTTGGG + Intronic
1179589653 21:42398009-42398031 ACAAGGAGGCTGCACCTCATGGG + Intergenic
1180066973 21:45417435-45417457 ACAGGGAACCTGCAGGTGAAAGG - Intronic
1181571369 22:23769360-23769382 ATAAGGAAGGAGCAGGTCAAGGG + Intronic
1184196986 22:42936425-42936447 ACAAGGGAACTGAAGGTCAGAGG - Intronic
1184514501 22:44953656-44953678 ACCTGGAAGCTGCAGGTCTCAGG - Intronic
1184868538 22:47218724-47218746 AGAATGAAACTGCAGGTCAGGGG + Intergenic
950799755 3:15540709-15540731 ACAAGGAAGCAGGAGGACCTTGG - Intergenic
951989070 3:28655726-28655748 ACATGGAAGGTGCTGCTCATGGG - Intergenic
953056509 3:39391773-39391795 ACAAGCAGACTGCAGGTTATGGG - Intronic
953361136 3:42297794-42297816 ACAAGGCAGCTGGATGTCCTGGG + Intergenic
953949830 3:47180731-47180753 ACAAGGAAGCTGCAGAATATTGG - Intergenic
953995752 3:47518450-47518472 CCAAGGCAGCTGGAGTTCATAGG - Intergenic
957231703 3:77526182-77526204 ACAGGGAAGCTTCAGACCATAGG - Intronic
959430850 3:106253009-106253031 ACAGGTAAGTTGCATGTCATGGG - Intergenic
961019562 3:123493489-123493511 AAAAGGCAGCTGCAGGGGATGGG + Exonic
962952485 3:140232247-140232269 ACAAGGGAACTGGAGCTCATTGG - Intronic
964724559 3:159800695-159800717 TTAGGGAAACTGCAGGTCATGGG - Intronic
966266990 3:178058255-178058277 TCAAGAAAGCTGTGGGTCATAGG + Intergenic
967810211 3:193753465-193753487 ACAAGACAGCTAGAGGTCATGGG - Intergenic
969425372 4:7121111-7121133 AGGAGGAAGCTGCAGGGCCTGGG - Intergenic
971450331 4:26794106-26794128 ACAAGGAAGATGCATATTATAGG + Intergenic
974259446 4:59506070-59506092 ACAAGTAAGTTGCATGTCATGGG - Intergenic
975961489 4:79912924-79912946 ACCAGCATGCTGCAGGTAATGGG + Intronic
976362634 4:84197643-84197665 AGCAGGAGGCTGCAGCTCATTGG - Intergenic
977286889 4:95118844-95118866 ACAAGGAGGCTGCCGGGGATAGG + Intronic
978459710 4:108937560-108937582 ACAGAGATGCTGCAGGTCAAAGG - Intronic
979448869 4:120845056-120845078 ACAAGGAAGCTGCAGAAGAAAGG + Intronic
979553577 4:122019160-122019182 ACAAGGCAGCTTCAGCTCAGAGG + Intergenic
982440181 4:155425479-155425501 AGAAGGGAGCTGCAGGATATGGG + Intergenic
983557354 4:169070285-169070307 ACAAGGAAGCTGTGGTTCACAGG + Intergenic
984373458 4:178895910-178895932 TCAAGAAAGCTTGAGGTCATAGG - Intergenic
984838635 4:184047523-184047545 ACAAGTAATTTGAAGGTCATGGG + Intergenic
987071060 5:14337557-14337579 ACATGGAAGCTTGTGGTCATAGG + Intronic
990018630 5:51098380-51098402 ACCAGGAAGCTGCTGATCACCGG + Intergenic
990021127 5:51128579-51128601 ACATGGAAGCTGCAAGACTTGGG - Intergenic
991261713 5:64675312-64675334 ACAGGTATGCTGCAGGTCAGGGG + Intergenic
991672138 5:69058360-69058382 TCAGGGAAACTGCAGGACATTGG - Intergenic
993220030 5:85082348-85082370 ACAAGGAAGCTAAAAGTAATGGG - Intergenic
993559681 5:89390449-89390471 ACAAGGTAGTAGCAGCTCATTGG + Intergenic
995681821 5:114728830-114728852 ACAGGGAAGTGGCAGGTAATGGG - Intergenic
997740960 5:136253661-136253683 ACAGGGAAACAGCAGGTCAGTGG - Intronic
997824962 5:137098189-137098211 ACAAGGAAACTGGAGAGCATAGG + Intronic
997977373 5:138448327-138448349 AGAAGGGAGCTGCAGGGCATGGG + Intergenic
998706830 5:144771823-144771845 ACATGGGAGGTACAGGTCATAGG - Intergenic
998977274 5:147662205-147662227 ACAACAAAACTGCAGATCATTGG + Intronic
1000408085 5:160909863-160909885 ACATGGAAGCTGCCGGTTGTAGG + Intergenic
1001242417 5:170080623-170080645 ACAAAGAAGCCACAGGTCTTAGG - Intronic
1004149265 6:13099507-13099529 ACAAGCAAGCTGCACCCCATGGG - Intronic
1004845625 6:19638683-19638705 ACTAGGAAGCTGCAGTTGAAAGG - Intergenic
1005997045 6:30937976-30937998 AAGAGGAAGCAGCAGTTCATGGG + Intergenic
1007345242 6:41224050-41224072 ATGAGGAAGCTGCAGGTGACAGG - Intergenic
1007489400 6:42206791-42206813 ACAACTGAGCTGAAGGTCATGGG + Exonic
1010096821 6:72056357-72056379 ACATGTAAACTGCATGTCATGGG - Intronic
1010280613 6:74018849-74018871 ACAAGGAAACTGCAGTTCCCAGG + Intergenic
1010748842 6:79595298-79595320 AAAAGGAATCTGCTGTTCATCGG + Intergenic
1012704206 6:102500186-102500208 ACAAGGAAGCTGCCAACCATAGG - Intergenic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1014290129 6:119548486-119548508 ACAAGGAACCTGGAGGGTATAGG - Intergenic
1015458237 6:133455000-133455022 ACAAGGAAACTGAAGTTCAGGGG - Intronic
1016314703 6:142772589-142772611 ACAATGCTGCTGCAGATCATGGG + Exonic
1017801480 6:157900067-157900089 ACTAGGGAGATGCAGGTCAAAGG - Intronic
1017917262 6:158841068-158841090 ACAGGGAAGTTGCAGATCTTGGG + Intergenic
1019609216 7:1928495-1928517 TCTAGGGACCTGCAGGTCATGGG - Intronic
1020806996 7:12802341-12802363 ACCAGGAAGCAGGAGGACATGGG - Intergenic
1022015167 7:26343386-26343408 ACAAGAAAGCGGAAGGTCAGAGG - Intronic
1023684044 7:42717071-42717093 ACTAGGAGGCTGCTGGTCACAGG - Intergenic
1029743352 7:102503481-102503503 ACCAGGCAGCTGCAGGCCAGTGG + Intronic
1029761341 7:102602642-102602664 ACCAGGCAGCTGCAGGCCAGTGG + Intronic
1030770385 7:113468002-113468024 ACAAGGAAGCTACAGACCAAAGG - Intergenic
1032550498 7:132779988-132780010 ACATGGAAGCCGGAGGTCAGTGG - Intergenic
1034863195 7:154617859-154617881 ACAAAGATTCTCCAGGTCATCGG + Intronic
1038337482 8:26656982-26657004 ACCAGGAAGCAGCAGGCCCTCGG - Exonic
1038490852 8:27970068-27970090 AGAAGGATGCTGCATGTCTTTGG - Intronic
1040510110 8:48085692-48085714 ACAAGGATGCTGCTGGTCTCAGG - Intergenic
1043111583 8:76190687-76190709 ACAAAAAAGCTGTAGGTCTTTGG - Intergenic
1043660599 8:82736094-82736116 ACATGCAAGCTGCATGTCTTGGG - Intergenic
1044598551 8:93981332-93981354 ACCCGGGAGCTGCAGGTCATCGG - Intergenic
1044924104 8:97195258-97195280 ACCAAGAAACGGCAGGTCATAGG - Intergenic
1045675486 8:104603228-104603250 AGAAGGAAGTTGCAGCTCAAGGG - Intronic
1048226975 8:132597218-132597240 ACAAGAAAGATGCAGTTGATGGG + Intronic
1049342640 8:142121368-142121390 ACGAGGAAGCTGCGGCTCACGGG + Intergenic
1052471703 9:28905186-28905208 ACAGGGAAGCTCCACGCCATTGG + Intergenic
1055132090 9:72787161-72787183 ATAAGGAAGCTGAAGCTCAAAGG - Intronic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1055551360 9:77434748-77434770 GCACAGAAGCTGCAGGTCTTGGG - Intronic
1057056579 9:91966221-91966243 ACATGGAGTCTGCAGGTCACTGG - Intergenic
1058726164 9:107806578-107806600 ACAAGGAACTTGGAGGTCCTTGG - Intergenic
1059182902 9:112236413-112236435 ACAAGCAAGCTCAAGATCATAGG + Intronic
1059239664 9:112793347-112793369 AGATGGAAGCAGCAGCTCATAGG - Intronic
1059275661 9:113094786-113094808 ACAAGGATGGTGCAGGGCAATGG + Intergenic
1059656361 9:116361173-116361195 GCATGGAAGCTGAAGGTCACAGG + Intronic
1186400331 X:9252573-9252595 ACAAGGCAGCTTCAGCCCATTGG + Intergenic
1187940487 X:24376018-24376040 TGAGGGAAGCTGGAGGTCATCGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190137329 X:47808620-47808642 ACATGGAACCTTCAGGTCAGTGG - Intergenic
1192483973 X:71509141-71509163 ACTAGGAAGTGGCAAGTCATGGG + Intronic
1192764266 X:74126247-74126269 ACAGGAAGGCTACAGGTCATGGG + Intergenic
1192986419 X:76404414-76404436 ATAAGGAAGTTGTTGGTCATAGG + Intergenic
1195008432 X:100710805-100710827 ACCAGGTAGCTGGAGTTCATAGG + Intronic
1195286003 X:103384896-103384918 GCAAGGAAGCTGGAGTTCACAGG - Intergenic
1195467664 X:105197811-105197833 ACAGGTAAACTGCATGTCATGGG + Intronic
1196569700 X:117250976-117250998 ACAAGAAAGCTCCATGGCATTGG - Intergenic
1196710489 X:118757065-118757087 ACAAGGAAGGAGCAGGGCAGAGG + Intronic
1197372688 X:125644369-125644391 ACAGGCAAACTGCATGTCATGGG + Intergenic
1197495617 X:127174824-127174846 ACAGGGAAGGGGCAGGCCATAGG + Intergenic
1198769297 X:140111820-140111842 ACAAGGAACCTACAGGGCAGGGG + Intergenic
1199582561 X:149374978-149375000 AGAAGGAAGCTGAAGCTCAGAGG - Intergenic