ID: 924380103

View in Genome Browser
Species Human (GRCh38)
Location 1:243455057-243455079
Sequence ATGCTGTAATTCATAAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924380102_924380103 25 Left 924380102 1:243455009-243455031 CCAAAAGCAATATTAATTTTGAA 0: 1
1: 0
2: 4
3: 86
4: 819
Right 924380103 1:243455057-243455079 ATGCTGTAATTCATAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924380103 Original CRISPR ATGCTGTAATTCATAAGACA AGG Intronic
No off target data available for this crispr