ID: 924380304

View in Genome Browser
Species Human (GRCh38)
Location 1:243456980-243457002
Sequence CAATCTGCTCCCCTAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924380304_924380305 11 Left 924380304 1:243456980-243457002 CCAAATTCTAGGGGAGCAGATTG 0: 1
1: 0
2: 2
3: 12
4: 102
Right 924380305 1:243457014-243457036 ACAGTGATGAACTTCCAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 168
924380304_924380307 19 Left 924380304 1:243456980-243457002 CCAAATTCTAGGGGAGCAGATTG 0: 1
1: 0
2: 2
3: 12
4: 102
Right 924380307 1:243457022-243457044 GAACTTCCAAAAAGGAAAATGGG 0: 1
1: 0
2: 2
3: 47
4: 463
924380304_924380306 18 Left 924380304 1:243456980-243457002 CCAAATTCTAGGGGAGCAGATTG 0: 1
1: 0
2: 2
3: 12
4: 102
Right 924380306 1:243457021-243457043 TGAACTTCCAAAAAGGAAAATGG 0: 1
1: 1
2: 2
3: 60
4: 603
924380304_924380308 22 Left 924380304 1:243456980-243457002 CCAAATTCTAGGGGAGCAGATTG 0: 1
1: 0
2: 2
3: 12
4: 102
Right 924380308 1:243457025-243457047 CTTCCAAAAAGGAAAATGGGCGG 0: 1
1: 0
2: 1
3: 48
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924380304 Original CRISPR CAATCTGCTCCCCTAGAATT TGG (reversed) Intronic
900413263 1:2523302-2523324 CAATCTGATCCCCTAGCCTGTGG + Intronic
901428910 1:9200454-9200476 CAATTCCCTCCCCCAGAATTAGG - Intergenic
902418372 1:16257006-16257028 TAATTTGCTCACCTAAAATTAGG + Intronic
905034427 1:34908105-34908127 CTATCTCCTCACCTAGAATGTGG + Intronic
905395970 1:37666858-37666880 GAAGCTGCTCCTCTGGAATTTGG + Intergenic
906397335 1:45477768-45477790 GACTCTGCTCCACTATAATTAGG + Intronic
906397339 1:45477806-45477828 TACTCTGCTCCACTATAATTAGG + Intronic
911388340 1:97205905-97205927 CAATGTGGTTCACTAGAATTGGG + Intronic
913136283 1:115892502-115892524 CAATCTGGTAACCTGGAATTTGG - Intergenic
915143420 1:153780495-153780517 CAAACTGCTCCCCCAGAATCAGG + Intergenic
917131452 1:171746384-171746406 CACTCTCTTCCCCTAAAATTGGG + Intergenic
918168518 1:181973830-181973852 CAATCTTCACCCCAAGAATCTGG - Intergenic
918985836 1:191624120-191624142 CAATGTGCTCAGCTAGAAATTGG - Intergenic
919482565 1:198108002-198108024 CACTCTGCTCTCCTAGAATTTGG - Intergenic
923358998 1:233188963-233188985 CAATTTCCTCCCCTTGAATGTGG - Intronic
923989838 1:239424150-239424172 CAATGTGCTTCCATAGATTTCGG + Intronic
924380304 1:243456980-243457002 CAATCTGCTCCCCTAGAATTTGG - Intronic
1065937403 10:30532811-30532833 TAATCTGTTCCCATAGAATTGGG - Intergenic
1069172750 10:65254231-65254253 CAGTTTGCTCCCGTAGAAGTGGG - Intergenic
1070144595 10:73764553-73764575 CTGTCTTCTCCCCTACAATTTGG - Intronic
1071085893 10:81868483-81868505 CATTCTGCTTCCTTAGATTTTGG - Intergenic
1076099473 10:127764095-127764117 CAAACTGCTACCCTAAAATCTGG - Intergenic
1081466773 11:43326688-43326710 TAAACTGCTCCCTTAGAAATCGG - Intronic
1083422059 11:62559333-62559355 GAATCTGATCCCTAAGAATTAGG + Intergenic
1086158775 11:83697444-83697466 CCATCTGCTTCCCAAGACTTTGG - Intronic
1087254631 11:95940008-95940030 CATCCTGTTCCCCTATAATTTGG + Intergenic
1090211773 11:124925767-124925789 CAATCTGTACCCCTAGAAGAAGG + Intronic
1094016015 12:25865433-25865455 CAATCTGCACCTATAAAATTAGG + Intergenic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1101711503 12:107271215-107271237 AAACCTGCTCTTCTAGAATTAGG - Intergenic
1103170692 12:118816923-118816945 CTGTCTGCTCCCCTTGAATCTGG + Intergenic
1107050740 13:36045973-36045995 CAGTCTTCTTTCCTAGAATTGGG - Intronic
1107675485 13:42792399-42792421 CAATCTCCTCCCCTAAAGTCTGG + Intergenic
1108470096 13:50758899-50758921 CAATCTTCTCCCCTTGAATGTGG - Intronic
1109574059 13:64230214-64230236 CAAGCTGCTCCCCTAAGGTTGGG - Intergenic
1111945860 13:94665234-94665256 CTATCTACTCCCCTAAGATTAGG + Intergenic
1113743242 13:112725279-112725301 CACTCTGCTCCCAAAGCATTTGG - Intronic
1116420564 14:44727445-44727467 CAATCTTCTCCCCTTGAGTGTGG - Intergenic
1118728500 14:68649753-68649775 CAATCTGCTCCCCCAGTGATTGG - Intronic
1121247585 14:92473406-92473428 CAATCTCCTGCCCCAGGATTTGG - Intronic
1121249033 14:92485927-92485949 CATTCTACTCCCCCAGAATGAGG - Intronic
1121444746 14:93971394-93971416 TCATCTGCTGCCCTAGACTTTGG + Intronic
1125197066 15:37059161-37059183 CAGTCTGCTCCCCTAGTAACTGG - Intronic
1129202373 15:74011188-74011210 CACTCTTTTCCCCTTGAATTTGG - Intronic
1132135061 15:99328377-99328399 AAAACTCCTTCCCTAGAATTCGG - Intronic
1138064426 16:53925797-53925819 CAATATGCCCCACAAGAATTAGG + Intronic
1139423823 16:66866529-66866551 CAGCCTGCTCCCCCAGGATTTGG - Intronic
1140959440 16:79897897-79897919 CAATCTGCTCTCCCAGCACTAGG + Intergenic
1144111619 17:12040677-12040699 CAATCTGATTCCCAAGTATTGGG - Intronic
1144396152 17:14845078-14845100 TTATTTTCTCCCCTAGAATTTGG - Intergenic
1146458093 17:33022702-33022724 CCATATGCTCCACTAGAACTTGG + Intronic
1152656120 17:81519888-81519910 CACTCTGCTCCCCTAGCAGATGG + Intronic
1156363409 18:36404094-36404116 CAATCTGCTCCCTGAGGGTTTGG + Intronic
1158671927 18:59483506-59483528 CAATTTGCTGCACTACAATTTGG + Intronic
1161227852 19:3155541-3155563 CAACCTGCTCCCCTCTAATATGG + Intronic
1165318086 19:35068801-35068823 CCATCAGATCCCCTAGAATAAGG - Intergenic
928625909 2:33139753-33139775 GAATTTACCCCCCTAGAATTGGG + Intronic
930305852 2:49673563-49673585 CAATCTTCTCCCCTTGAATTCGG - Intergenic
930454061 2:51582204-51582226 CTATGTGCTCCCCTAGAGGTTGG + Intergenic
936668376 2:114625912-114625934 CATTCTGCACTCCTAGATTTTGG - Intronic
938212664 2:129481729-129481751 CATTCTTCTCCCCTTGAATCTGG + Intergenic
938679648 2:133676641-133676663 CAATGTCCTCCCTTAGATTTTGG + Intergenic
942725955 2:179008381-179008403 CAACCTGCTCCCGCAGCATTTGG + Intronic
947647605 2:231755418-231755440 CAATCAGCTTCCCCAGAATTGGG - Intronic
1170356547 20:15497861-15497883 CTATTTCCTCCCCTAGACTTTGG + Intronic
1173576896 20:44118073-44118095 CTCTCTGCTCCCCTAGATTTTGG + Intronic
1178051190 21:28749389-28749411 CAATCTCCTCCTCTAAAAATGGG - Intergenic
1181856828 22:25787729-25787751 GAAGCTGCCCCCCTAGTATTTGG - Intronic
1181929771 22:26391271-26391293 CAATCTGTTCCCCAGCAATTGGG + Intergenic
1183361701 22:37386327-37386349 CACTCTGCTCACCTAGGACTGGG + Intronic
1183397147 22:37578261-37578283 CAATTTGCTCTCCAAGACTTGGG + Intronic
1185098965 22:48827452-48827474 CAATCATATTCCCTAGAATTGGG + Intronic
951538632 3:23761966-23761988 CCATCTGCTCCCCAAGAAGTGGG + Intergenic
955442383 3:58970705-58970727 CAATTTCCTCCCCTATAAATTGG + Intronic
960162713 3:114367926-114367948 CAATCTCCTCCCATAGATCTAGG + Intronic
963792073 3:149593718-149593740 CCCCCTGCTTCCCTAGAATTGGG - Intronic
965923116 3:173943538-173943560 GAGTCTGGTCCCCTTGAATTGGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967350457 3:188508875-188508897 AAATCTGCTGGCCTAGAATTTGG - Intronic
969949384 4:10818778-10818800 AATTCTCCTCCCCTAGAATCAGG + Intergenic
972708108 4:41565671-41565693 CCATCAGATCCCCTAAAATTTGG - Intronic
975098991 4:70490966-70490988 CAATCTGCTCTCCCCGACTTTGG + Intergenic
976278758 4:83306162-83306184 TAATCTACTCCACTAGAATTAGG + Intronic
980577784 4:134707883-134707905 CAATCTGCTACCCCAAAATCTGG - Intergenic
987189849 5:15465187-15465209 TAATCTGCTCCCCTTGAATGTGG - Intergenic
990675142 5:58175886-58175908 CAGGCTTCTCCCCTAGATTTTGG + Intergenic
994884777 5:105546212-105546234 CAAACTGCTGCCCAAGAATTGGG + Intergenic
995571319 5:113485558-113485580 ACATCTTCTTCCCTAGAATTTGG + Intronic
997877382 5:137561382-137561404 CATTCTGCACCCCTGGAATGGGG + Intronic
999243481 5:150140652-150140674 TACTCCGCTCCCCTAGACTTGGG - Intronic
999243488 5:150140680-150140702 CAGTCTGCTCCCCTGGACTTGGG - Intronic
999533525 5:152489411-152489433 CAACCTTCTCCCCTTGAATGGGG - Intergenic
1003410970 6:5862779-5862801 CAGTCTGCTCCCCTGCAAATGGG - Intergenic
1004030133 6:11860141-11860163 GAATCTTCTCCCCTTGAATGTGG + Intergenic
1007166018 6:39829718-39829740 CAGTCTGCATCCCTAGAATGAGG - Intronic
1007853299 6:44826569-44826591 TCATCTGCCCCCCTGGAATTTGG - Intronic
1010749794 6:79605031-79605053 AATTCATCTCCCCTAGAATTTGG + Intergenic
1012123237 6:95393094-95393116 CAATCTCCTTCCCAATAATTTGG - Intergenic
1012690091 6:102299768-102299790 CAATCTGCTCTGCTAGAAACGGG + Intergenic
1023177064 7:37445791-37445813 CATTCTGCTCTCCTACAATATGG - Intronic
1028147340 7:87332557-87332579 TATTCTGCTTCCCTAGAAATAGG + Intergenic
1029898006 7:104006861-104006883 CAGTTTGCTACCCTAAAATTTGG + Intergenic
1040779871 8:51095124-51095146 CCATTTGCTCCCCTAGAAAGTGG + Intergenic
1041903951 8:63011560-63011582 CACTCTGCTAGCCTAGATTTTGG + Intergenic
1042289083 8:67148843-67148865 AAATCTGAGCACCTAGAATTGGG - Intronic
1042391874 8:68245431-68245453 CAATCTGCTGCCTTGGACTTGGG - Intergenic
1045284620 8:100779662-100779684 CAGTCTGCTCCCAGAGATTTAGG + Intergenic
1048195957 8:132331996-132332018 CAATCCCCTCCCCTTGAATGTGG + Intronic
1052766763 9:32649485-32649507 TAATCTCCTCCCCTAGAGTTTGG + Intergenic
1057884418 9:98819251-98819273 CATTCTCCTCCCCTTGAATGTGG + Intronic
1186262382 X:7792976-7792998 CATTCTGCTTCCCTACAAATAGG + Intergenic
1186954571 X:14668354-14668376 TAATCTGCTCCCCTTGACTATGG - Intronic
1189064250 X:37789348-37789370 TAATCTCCTCCCCTTGAGTTTGG - Intronic
1192717520 X:73659890-73659912 CGTCCTGCTCCCCTATAATTTGG - Intronic
1193520923 X:82528217-82528239 CAGTCAGCTCCCATGGAATTAGG - Intergenic
1199514623 X:148662391-148662413 GCATCTTCTCCACTAGAATTAGG - Exonic
1199813842 X:151379048-151379070 CAATCCCCTCTCCTAGAATGTGG + Intergenic