ID: 924380760

View in Genome Browser
Species Human (GRCh38)
Location 1:243462122-243462144
Sequence GAGGGAATGAAGGGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 512}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924380749_924380760 18 Left 924380749 1:243462081-243462103 CCTCTCTCCACCACTTCTCAACC 0: 1
1: 0
2: 2
3: 46
4: 535
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380750_924380760 11 Left 924380750 1:243462088-243462110 CCACCACTTCTCAACCCTGCATC No data
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380748_924380760 19 Left 924380748 1:243462080-243462102 CCCTCTCTCCACCACTTCTCAAC 0: 1
1: 0
2: 2
3: 57
4: 619
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380751_924380760 8 Left 924380751 1:243462091-243462113 CCACTTCTCAACCCTGCATCAGT 0: 1
1: 0
2: 1
3: 37
4: 264
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380753_924380760 -4 Left 924380753 1:243462103-243462125 CCTGCATCAGTGTAGCACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380752_924380760 -3 Left 924380752 1:243462102-243462124 CCCTGCATCAGTGTAGCACAGAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512
924380747_924380760 24 Left 924380747 1:243462075-243462097 CCTTACCCTCTCTCCACCACTTC 0: 1
1: 0
2: 6
3: 56
4: 698
Right 924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG 0: 1
1: 0
2: 8
3: 49
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924380760 Original CRISPR GAGGGAATGAAGGGGGCTGC AGG Intronic
900101115 1:962509-962531 GAGGGCATGCAGGTGGCTGAGGG + Intronic
900143709 1:1149259-1149281 GAGGGAATGAAGTGGGGTCCGGG + Intergenic
901013809 1:6216217-6216239 GGGGACATGAAGGGGGCTTCTGG + Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901391166 1:8947251-8947273 TATGGAAAGAAGGGGGATGCGGG - Intronic
901445660 1:9306391-9306413 GATGGAGTGGAGGGGGCTGTGGG + Intronic
901793347 1:11666121-11666143 TAGGGAAAGAAGGAGCCTGCTGG - Intronic
902228031 1:15009068-15009090 GCTGGAGGGAAGGGGGCTGCTGG - Intronic
902251403 1:15156003-15156025 GTGGGAATGAATGGGGGAGCTGG + Intronic
902275515 1:15336896-15336918 GAGTTGGTGAAGGGGGCTGCTGG - Intronic
902730246 1:18364402-18364424 GAGGGACTGCAGGGGGGTGAAGG - Intronic
903044397 1:20554231-20554253 GAGGGAATGAGGAGGTCTGTGGG - Exonic
903666963 1:25014054-25014076 AAGGGGAGGATGGGGGCTGCGGG - Intergenic
903669774 1:25028501-25028523 GAGGGCATGGGGGGTGCTGCAGG + Intergenic
903977379 1:27159696-27159718 GAGGGAAAGGATGGGGCTGGTGG + Intronic
904410606 1:30322544-30322566 GGGGGGAGGAAGGGGGCTGGGGG + Intergenic
904482960 1:30805525-30805547 GGGGGTGGGAAGGGGGCTGCCGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
904864212 1:33563823-33563845 GAGGAAATGAAGAGGACAGCTGG + Intronic
905459671 1:38114328-38114350 GGGGGAATGAAGCTGGCTTCTGG - Intergenic
905766634 1:40607228-40607250 GAGGGAAGGGAGGGAGCTGAAGG - Intergenic
906069656 1:43007658-43007680 GAGGGGAAGGAGGGGGCCGCGGG - Intergenic
906227953 1:44137605-44137627 GAATGAATGAAGAGGGCTTCTGG + Intergenic
907468329 1:54654237-54654259 GAAGGAAGGAAGGGGACAGCAGG + Intronic
907725326 1:57015221-57015243 GTGGGCATGAAGGCGGCTGGCGG + Exonic
907817994 1:57938785-57938807 GAGGGAAGGACAGTGGCTGCAGG - Intronic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
912176759 1:107168161-107168183 GAAGGAAATAAGGGGGATGCGGG - Intronic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912777257 1:112513534-112513556 GTGGGAATGCAGGGGGGTGGTGG + Intronic
914675493 1:149904658-149904680 GAGGGAATGATGGGGAAGGCAGG + Exonic
914827355 1:151145650-151145672 GAGGGGCTGGAGGGGCCTGCAGG + Intronic
915102022 1:153507612-153507634 GAGGGATGGCAGGGGGCAGCAGG - Intergenic
915350196 1:155219650-155219672 GAGTAAATGAGGGGTGCTGCAGG - Intergenic
915497624 1:156292942-156292964 GGGGGAGTGAAGGGGCCGGCTGG + Exonic
915572071 1:156750332-156750354 GAGGAAAGGAGGGGGGATGCGGG - Intronic
916666864 1:166975003-166975025 GAGAGAATGATGGGGGCGGCGGG - Intronic
916739755 1:167637792-167637814 GAAGGAATGAGCGGGGCTGCAGG - Intronic
917930100 1:179817083-179817105 GGGGAAGTGAAGGGGGCTGTTGG + Intergenic
918326910 1:183418559-183418581 GATGGAGTGAAGTGGGCTGGGGG - Exonic
919882883 1:201912390-201912412 GAGGGAGTGAAGGGAGCTGTGGG - Intronic
919980417 1:202639487-202639509 GAGGCACTGAAAGGGGCTGTGGG - Intronic
920180045 1:204127029-204127051 GAGGGAGTGAAGGGGAGGGCAGG - Exonic
920331376 1:205211062-205211084 GAGGGGAGGAAGGGGCCCGCTGG - Intronic
920807146 1:209245638-209245660 GAGGGCAGGCAGGGGCCTGCTGG + Intergenic
921257453 1:213355274-213355296 GAGTGGGTGAAGGGGGCTGGTGG + Intergenic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
922727045 1:227927446-227927468 GAGGGAAGGAAGGGCAGTGCAGG + Intronic
923215957 1:231847953-231847975 GAAGAAATGAAGAGAGCTGCTGG + Intronic
923475422 1:234326987-234327009 GAGGGCATGAAGTGACCTGCTGG + Intergenic
924101172 1:240604070-240604092 GAGAGAAGGAAGGGAGGTGCCGG + Intronic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1062826323 10:571461-571483 GAGTGAAGGAGGGGGGATGCAGG - Intronic
1063120356 10:3101514-3101536 GAAGGAGTGGAGTGGGCTGCTGG + Exonic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1066464717 10:35641659-35641681 GGGGGTTTGAAGGCGGCTGCAGG + Exonic
1067897037 10:50193627-50193649 GAGGGGATGAGGGGTGCTGGGGG + Intronic
1067951936 10:50748413-50748435 GAGGGGATGAGGGGTGCTGGGGG - Intronic
1068785482 10:60967990-60968012 GAGGGAAAGAAGGGAGCAGAGGG + Intronic
1069686307 10:70321345-70321367 GTGAGAATGAAAGGGCCTGCTGG - Intronic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1070035511 10:72718994-72719016 GAGGGTATGAAGGGGGCTCCTGG + Intronic
1070554616 10:77518003-77518025 GAGGGAACGAGGCTGGCTGCTGG - Intronic
1071568538 10:86684149-86684171 GAGGAGAAGAAGGGGGCTGCTGG - Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072757116 10:98029010-98029032 GAGGTAATGAAGGGAGTTGAGGG - Intronic
1072795086 10:98348583-98348605 GAGGGATTGAAGTGAGCAGCGGG - Intergenic
1072801107 10:98393027-98393049 GAGGGAATGCAGGGGGCCTGGGG - Exonic
1073516379 10:104079101-104079123 GTGGGAAGGAAGGGTGCTCCTGG + Intronic
1074065214 10:110007716-110007738 GAGGGCGCGGAGGGGGCTGCGGG + Intronic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074596765 10:114875148-114875170 GAGGGAAGGAAGGCGGCCGGCGG + Intronic
1074688045 10:115977697-115977719 GGGGGAATGTAGGGGGCACCAGG + Intergenic
1074700533 10:116088210-116088232 TAGGGAATGAAGTGGGTTGTGGG + Intronic
1075616447 10:123893481-123893503 GAGGGAGAGGAGGAGGCTGCTGG + Intronic
1075905806 10:126081088-126081110 GCTGGATTCAAGGGGGCTGCAGG + Intronic
1076719332 10:132386411-132386433 GAGGGCATGAAGGTGGCCTCCGG - Intergenic
1077064832 11:636564-636586 GAGGGAATGGAGGAGGGAGCGGG + Intergenic
1077150376 11:1070466-1070488 GGGGGAATGAATGGGTCAGCAGG - Intergenic
1077268933 11:1666115-1666137 GGGGCAGTGCAGGGGGCTGCTGG + Intergenic
1077271819 11:1685065-1685087 GGGGCAGTGCAGGGGGCTGCTGG - Intergenic
1079045693 11:17100669-17100691 GAGGGTAGGAAGGGGGATGGTGG - Intronic
1080365833 11:31573024-31573046 GAGGGAGAGAAGGGGGCAGGAGG + Intronic
1080431930 11:32207409-32207431 GAGGGGCTGAAGGGTGCTGTTGG - Intergenic
1081910345 11:46696228-46696250 GAGGGAATGGTGGGGGCAGGAGG - Intronic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082884196 11:58066589-58066611 GAGGCAAGGATGGGGGCTGCTGG - Intronic
1083198732 11:61106516-61106538 CAGGGAATGAAGGGACCTGGGGG + Intronic
1083285572 11:61656573-61656595 GTGAGAATGCAGGGGGGTGCGGG + Intergenic
1083623141 11:64058816-64058838 GAGGGCGTGAAGAGGGCAGCCGG + Intronic
1084086527 11:66857571-66857593 GAGGGAAGGTTGGGGCCTGCAGG - Exonic
1084256519 11:67946640-67946662 GAGGGAAGAGAGGGGGCTGTGGG - Intergenic
1084593301 11:70102859-70102881 GAGGAAGTGCAGGGGGCTGTGGG - Intronic
1084602567 11:70154933-70154955 GAGGGAATGAGGGGCGCAGAGGG - Intronic
1087098987 11:94347247-94347269 GAGGGAAAGAAGGAGGATTCGGG - Intergenic
1087701411 11:101440502-101440524 GAGGGAAGGAGGGGGACAGCAGG - Intergenic
1088223088 11:107590666-107590688 GTGGGAAAGGCGGGGGCTGCCGG + Intergenic
1088649944 11:111948691-111948713 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1088675370 11:112187530-112187552 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1089630588 11:119781789-119781811 AAGGGAATGAAGGAGGCAGGAGG - Intergenic
1089688295 11:120170482-120170504 GGGGCAGGGAAGGGGGCTGCAGG - Exonic
1089768379 11:120785048-120785070 ACGGGAGTGATGGGGGCTGCTGG - Intronic
1090254739 11:125275525-125275547 GAGGGAGTAAAGGGGGCTGGTGG + Intronic
1090653307 11:128824828-128824850 GAGGGAATGTTGGGGGACGCAGG + Intergenic
1091229821 11:133981055-133981077 GAGGGGATGAAGGGAGAAGCAGG + Intergenic
1091324180 11:134671772-134671794 GAGAGAGTGGAGGGAGCTGCTGG + Intergenic
1092211723 12:6650815-6650837 GGGGGAATGAAGAGGTCTGGGGG + Exonic
1092262405 12:6959685-6959707 GAGGGAAGGATGGTGGCAGCTGG + Intronic
1092786691 12:12032986-12033008 GAAGGAAGAAAGGGCGCTGCTGG + Intergenic
1094682707 12:32679739-32679761 GAGGGAAGGATGGGGCCGGCGGG + Intronic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096676725 12:53230310-53230332 GCATGGATGAAGGGGGCTGCCGG + Intronic
1097973830 12:65663939-65663961 GTGAGAAAGAAGGGAGCTGCGGG - Intergenic
1099139957 12:78960622-78960644 CATGTTATGAAGGGGGCTGCAGG + Intronic
1099257704 12:80334625-80334647 GAGAAAATGTAGGAGGCTGCAGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100285883 12:93165868-93165890 GGGGCAACTAAGGGGGCTGCAGG - Intergenic
1100478876 12:94959161-94959183 GATGGAATGAAGGGAACTGGGGG - Intronic
1100705527 12:97196443-97196465 GATAGAATAAAGGAGGCTGCAGG - Intergenic
1101266475 12:103093586-103093608 GAGGGAATTAGGTGGGCTCCAGG + Intergenic
1101694567 12:107112913-107112935 GAGGGAATGAAGAAGGCAGAGGG + Intergenic
1101862015 12:108490382-108490404 GAGGGCATGAAGGGGGAAGAGGG + Intergenic
1102451067 12:113042528-113042550 AAGGGACTGGAGGGTGCTGCTGG + Intergenic
1103239014 12:119398004-119398026 GATGGGAGGAAGGGGGCGGCGGG + Intronic
1103323072 12:120102766-120102788 GTGGGAAGGAAGGGGGCCGCTGG + Intronic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1104355080 12:128078126-128078148 GAATGAATGAAGCAGGCTGCAGG - Intergenic
1104357193 12:128097695-128097717 GAGAGAAGGAAGGTGGTTGCCGG + Intergenic
1104866782 12:131960731-131960753 GAGGGAGCGAAGGGAGCTGCGGG - Exonic
1104879910 12:132063671-132063693 GAAGGGAGGAAGTGGGCTGCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104939748 12:132389464-132389486 GAGGCAATTAACGTGGCTGCTGG - Intergenic
1108229227 13:48319506-48319528 GAAGGGCTGCAGGGGGCTGCTGG + Intronic
1108495476 13:51020397-51020419 GAGGGCAAAAAGGTGGCTGCAGG - Intergenic
1108715794 13:53076699-53076721 GAGGGGTTGAAGAAGGCTGCGGG + Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110648747 13:77918900-77918922 GAGGGAATGATGGGGGTCCCAGG + Intronic
1110862772 13:80361913-80361935 GAGGGAGTGACGGAGGCTGCAGG - Intergenic
1112133521 13:96550284-96550306 GAGAGAAAGAAGGGGGTTCCAGG - Intronic
1112144192 13:96679706-96679728 CTGGGAAAGAAGGGGGCTACAGG - Intronic
1113511305 13:110856865-110856887 GAGGGCTTGATGGGGGCTGGAGG + Intergenic
1113675892 13:112207750-112207772 GAGGAAATGAGAGGGGGTGCGGG + Intergenic
1113861769 13:113491307-113491329 GAGGGAAGGAAGGGGACCCCGGG - Intronic
1113865306 13:113518256-113518278 GAGGGACTTCACGGGGCTGCAGG - Intronic
1114033292 14:18595485-18595507 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1114078086 14:19174685-19174707 GAGGGAATGCAGAGAGCTGCGGG + Intergenic
1114125408 14:19719868-19719890 GAGGGAATGCAGAGAGCTGTGGG - Intronic
1114369027 14:22064907-22064929 GAGGGAATGAGGGGGGAGGTGGG + Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114462617 14:22897079-22897101 GAAGGAATGGATGAGGCTGCTGG + Intergenic
1114566566 14:23637509-23637531 GAGGGAGGGAAGGGGTCTCCAGG - Intronic
1114748328 14:25174551-25174573 GAGGGAAAGAAGGGGGATGTGGG - Intergenic
1116186992 14:41609784-41609806 GAGGCAGTGACTGGGGCTGCTGG + Intronic
1117555236 14:56877025-56877047 GATGGAATGATGGGAGATGCAGG + Intergenic
1117671623 14:58113111-58113133 GGTGGTATGAAGGGGGCTTCTGG - Intronic
1118708642 14:68502164-68502186 AATGGAAAGATGGGGGCTGCTGG + Intronic
1119541640 14:75442419-75442441 GATGGTATGAAGCGGGCTGGGGG - Intronic
1119599967 14:75968958-75968980 TAGGGAATGGTGGGGGCTGCGGG + Intronic
1119965858 14:78914830-78914852 AATGGAATGAAGGGGGCAACGGG + Intronic
1121356215 14:93217351-93217373 GAGGAAATGAAGGGAGAGGCAGG - Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121691943 14:95884303-95884325 GAGGGAAGCAAGGGGGCAGGTGG - Intergenic
1121710029 14:96030801-96030823 GAGGATATGGAGGAGGCTGCCGG + Intergenic
1121717134 14:96084310-96084332 TTGGGCATGACGGGGGCTGCAGG - Intronic
1121788704 14:96682493-96682515 GAGGGAATTAAGAGGGTTGATGG - Intergenic
1122781232 14:104144418-104144440 CAGGGAAGGAGGGGGACTGCAGG + Intronic
1202902249 14_GL000194v1_random:50617-50639 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1123898931 15:24856592-24856614 GAGGGAAGACAGGGGGCGGCTGG - Intronic
1124105046 15:26729722-26729744 GAGGAAGTGAAGGAGCCTGCTGG - Intronic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124439871 15:29678045-29678067 CAGGGAGTGAGGGGAGCTGCAGG - Intergenic
1124496114 15:30188317-30188339 GAGGCACTGAAAGGGGCTGTGGG - Intergenic
1124747460 15:32350330-32350352 GAGGCACTGAAAGGGGCTGTGGG + Intergenic
1124982061 15:34575822-34575844 GAGGGCATGGAAGGGGTTGCTGG - Intronic
1125506886 15:40272342-40272364 GAGGGACTTCTGGGGGCTGCTGG - Exonic
1125983611 15:44027591-44027613 GAAGGAATAAAGAGGGCTGGTGG + Intronic
1126436870 15:48645719-48645741 TGGGGAAAGGAGGGGGCTGCGGG - Exonic
1126856824 15:52847061-52847083 GAGGAAAAAAAGGGGGCTGTAGG + Intergenic
1127832720 15:62765013-62765035 GGGGGGATGAGGGGGGCTTCTGG - Intronic
1128228870 15:66021133-66021155 GAGGTGATGCAGGGGCCTGCAGG + Intronic
1128497125 15:68205017-68205039 GTGGGAAGGAAGGTGGCTGTGGG - Intronic
1129228765 15:74184873-74184895 GAGGGAGGGAAGGGCTCTGCCGG - Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129808346 15:78483552-78483574 AAGGAAAATAAGGGGGCTGCTGG - Intronic
1129879837 15:78999268-78999290 GTGGGAAGGAAGGGGCCTCCAGG + Intronic
1129993387 15:79984087-79984109 CAGGGAATGAAGGGAACTGGTGG - Intergenic
1130910089 15:88264888-88264910 AAGGGAATGAAGGTGGCAGTGGG + Intergenic
1131016127 15:89059130-89059152 GAGGGCATGATGGGAGATGCTGG - Intergenic
1132293917 15:100720961-100720983 GAGGGAATGAATGGGGAGTCAGG + Intergenic
1132356197 15:101173243-101173265 TAGTGAATGGAGGTGGCTGCAGG + Intergenic
1132485823 16:190348-190370 GAGGGAAGGTCGGGGCCTGCAGG - Intronic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132882471 16:2168529-2168551 TAGGGAATGAGCGGGGTTGCTGG + Intronic
1133442112 16:5829576-5829598 GAGGGGATGGAGGGGGATGTTGG - Intergenic
1134452787 16:14373669-14373691 GGGGGAAGGCAGGGAGCTGCTGG - Intergenic
1135182722 16:20289746-20289768 GAGAGGAAGAAGGGGGCTTCGGG - Intergenic
1135459033 16:22625201-22625223 AAGGAAATGAAAGGGGCTGGGGG - Intergenic
1135597756 16:23756313-23756335 GGGGGAAGGAAGGTGGCTGCTGG + Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1136544333 16:30947376-30947398 GGGGGAAAGAAGGGGGTGGCTGG - Exonic
1137724564 16:50648257-50648279 GAGGGAATGAAAGGGACTCTAGG - Intergenic
1137783069 16:51114083-51114105 GGGAGAAGGAAGGGGGCCGCAGG + Intergenic
1138434324 16:56988863-56988885 GAGGGACTGGAGGGGGCAGAAGG - Intergenic
1138656184 16:58492878-58492900 GAGGGAAAGGATGGGGCTGGAGG - Intronic
1140724202 16:77797497-77797519 GTGGGGATGCAGGGGGCTGGTGG - Intronic
1141575203 16:84959113-84959135 GAGGGTGTGAAGGTGGCTTCAGG - Intergenic
1141676123 16:85518263-85518285 GAGAGAATGAAGGGGGTCTCTGG + Intergenic
1141804510 16:86334034-86334056 GAGGCAGTGGAGGGGTCTGCGGG - Intergenic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142285678 16:89170630-89170652 GAGGGGGTGGAGGGGGCTGGAGG - Intergenic
1142359547 16:89619706-89619728 AAGGGAGTGCAGGGGGCTGCAGG - Intronic
1142359569 16:89619769-89619791 GAGGGGGTGCAGGGGGCTGCAGG - Intronic
1142868823 17:2807725-2807747 GTGGGAGTGCAGGGGGCTGGGGG + Intronic
1144849417 17:18236540-18236562 GAGTGAATGGAGGGGCGTGCAGG + Intronic
1146492536 17:33292747-33292769 AAGGGAAAGAAGGCGGCAGCCGG - Exonic
1147132136 17:38415766-38415788 GAGGGAAGGAGGGGGGCGGCGGG - Intergenic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1148335119 17:46835806-46835828 TGGGGAGTGAAGGGGGCTGAGGG - Intronic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1148507883 17:48142517-48142539 GATGAAATGAAGGGGGCAGTGGG + Intronic
1148862583 17:50612393-50612415 GAGGGAGGGACCGGGGCTGCTGG + Intronic
1149659193 17:58325557-58325579 GCGGGAGTGCAGGGAGCTGCAGG - Exonic
1149855364 17:60078402-60078424 GAGGGAGTGAAGGAGGGTGCGGG + Intronic
1150500159 17:65643119-65643141 GAGAAAATGGAGGGGGCTGAAGG + Intronic
1151106762 17:71624320-71624342 CAAGGAATGCAGGGGGCTTCTGG + Intergenic
1151296761 17:73192071-73192093 GAGGGAATGAGCAGGGATGCAGG + Intergenic
1151552944 17:74832349-74832371 GAGGATATGAAGGCGGGTGCTGG - Intronic
1151706976 17:75774344-75774366 TGGGGAATGAGGGAGGCTGCAGG - Intergenic
1151939475 17:77283397-77283419 GTGGGACTGGAGGGGGCTGATGG + Intronic
1152111217 17:78358683-78358705 GAGGGGAAGGAGGGGGCTCCAGG + Exonic
1152197371 17:78925481-78925503 GAGGGGGAGGAGGGGGCTGCTGG - Intergenic
1152241517 17:79163694-79163716 GAGGGAAGCAAGTGGGGTGCGGG - Intronic
1152404266 17:80087485-80087507 GAGGGGATGAAGGGAGCTACAGG + Intronic
1152461523 17:80444650-80444672 GAGGGAGTGGGGAGGGCTGCAGG + Intergenic
1152723011 17:81932022-81932044 CAGGGTATGCAGGGGGCTCCAGG - Intergenic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153784880 18:8525906-8525928 CAGGGAGAGAAGGGGGCTGTGGG - Intergenic
1154307209 18:13239346-13239368 GAGGGAACAAAGGGGAGTGCAGG + Intronic
1156483017 18:37447952-37447974 GATGGAAGCAAGGGAGCTGCAGG - Intronic
1157647483 18:49290787-49290809 GTGGGAGTGAAGGTGGCTTCAGG + Intronic
1160312697 18:77810705-77810727 GAGGGAGACAAGGCGGCTGCAGG - Intergenic
1160695824 19:483823-483845 GAGGGAAGGAAGATGGCTGCAGG - Intergenic
1160760558 19:782117-782139 GCGGCAGTGATGGGGGCTGCAGG + Intergenic
1160861048 19:1237382-1237404 GAGGGGAAGAGGGGGGCTCCTGG + Intronic
1160866816 19:1259836-1259858 GAGGGAAGGGTGGGGTCTGCGGG - Intronic
1161248217 19:3266790-3266812 GAGGGGCGGATGGGGGCTGCTGG + Intronic
1161398837 19:4058868-4058890 GAGGGAAGGAAGGCGGGTGGAGG - Intronic
1161849593 19:6731568-6731590 GAGGGAGGGGAGGGGGCTGGGGG + Intronic
1161986261 19:7656286-7656308 AAGTGAATGAAGGAGGCTGAGGG - Intergenic
1162107738 19:8380707-8380729 GAGGGAAGGAAGGGATCTCCAGG - Intronic
1162777768 19:12990188-12990210 GAGGGAGTGATGGGGGATGGAGG - Intergenic
1162811657 19:13167775-13167797 GAGAGAAGGAAGGGGGTTGGGGG - Intergenic
1163207201 19:15812461-15812483 GAAGGAAGGATGGGGACTGCAGG + Intergenic
1163241594 19:16067194-16067216 GGAGGAATGAAGAGGGCTGTGGG - Intronic
1163491217 19:17618162-17618184 GAGGGAAGGATGTGGGCTGGGGG - Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1163795431 19:19335172-19335194 GAGGGGAGGGAGGGGGCTCCAGG - Intronic
1164702173 19:30293420-30293442 TAGGGGATGTTGGGGGCTGCAGG + Intronic
1165854545 19:38871570-38871592 AAGGGAATGAATGGGGCTTTGGG - Intronic
1165941043 19:39414994-39415016 GAGGCCATGGTGGGGGCTGCAGG - Exonic
1166259546 19:41627920-41627942 GAGGGACTGGAAGGGCCTGCTGG + Intronic
1166524837 19:43504435-43504457 AAGAGATTGTAGGGGGCTGCTGG - Intronic
1166688138 19:44808303-44808325 GAGGGAATGAAGGAGAGAGCGGG + Intergenic
1167341442 19:48918845-48918867 GGGGGATTTAAGGGGACTGCAGG - Intronic
1167615311 19:50529902-50529924 CTGGGAATGAAGGGGGCCCCAGG - Intronic
1168237414 19:55071982-55072004 GAGTGAAGGATGGGGGCTGCAGG - Intergenic
1168242954 19:55096339-55096361 CAAGGAGGGAAGGGGGCTGCAGG + Intronic
1168417004 19:56175605-56175627 GAGGGATTGATGGGGGCAGAGGG + Intergenic
926040521 2:9669213-9669235 GAGTGAATGAATGGGCCTGGCGG - Intergenic
926163101 2:10501862-10501884 GAGGGAAGGAGGCTGGCTGCCGG - Intergenic
927208267 2:20623719-20623741 GAGGCGGTGAAGGGGGCTGAGGG - Intronic
927666559 2:25036831-25036853 TAGGGATTGGAGAGGGCTGCAGG - Intergenic
928943831 2:36754200-36754222 GAGGGAAGGAAGGGTGTTGATGG + Intronic
929594634 2:43168566-43168588 GAGGGGATGGAGGGCACTGCAGG + Intergenic
929978735 2:46659040-46659062 GAGGGCATGGAAAGGGCTGCAGG - Intergenic
931416768 2:62088937-62088959 GAGGGGGAGAAGGGGGTTGCAGG + Intronic
931739491 2:65228704-65228726 AAGGGAAAAAAGGGGGCTGGGGG - Intronic
932318432 2:70801965-70801987 GAAGGAGAGAAGGGGGCAGCGGG + Intergenic
932419756 2:71594632-71594654 GAGGGGATGAAGGGAGCACCAGG - Intronic
933474801 2:82776567-82776589 GAGGGAATTGAGGGGGTTGAGGG + Intergenic
933623974 2:84577599-84577621 GAGATAATGGAGGGGACTGCAGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934504436 2:94879814-94879836 GAGGGGTTGCTGGGGGCTGCTGG + Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
935627504 2:105183530-105183552 CAGGGAATGATGTGGGCTGAAGG + Intergenic
935643122 2:105309289-105309311 CAGAGAATGACGGGAGCTGCAGG + Intronic
937453238 2:122019662-122019684 GAGGGAATCAAAGGGGCTGCAGG + Intergenic
937956828 2:127426432-127426454 GGGGGCATGGAGGGGTCTGCAGG + Intronic
938722666 2:134080179-134080201 GGGGGAATGAAGGGAGCAGATGG - Intergenic
940419527 2:153463516-153463538 GAGGGATTGAGGGGTTCTGCAGG - Intergenic
940712634 2:157180743-157180765 TTGGGAATGAAGGGAGCTGATGG + Intergenic
942154741 2:173116407-173116429 TAGGGAATGCAGGGAGATGCTGG - Intronic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
943110755 2:183602596-183602618 GAGGGATTCGGGGGGGCTGCTGG - Intergenic
943667737 2:190628016-190628038 GAGGGACTGCGGGGGGCTGCTGG - Intergenic
943854617 2:192773353-192773375 GAGGGAATGAATGAGGAAGCAGG - Intergenic
944861008 2:203816022-203816044 GAGGGAATGAGGTGGGCTCTGGG + Intergenic
945773466 2:214075446-214075468 AAGGGCATGAAGGAGGCTTCTGG + Intronic
946078368 2:217095101-217095123 GTGGTAATGAAGTGGGCGGCGGG - Intergenic
947521105 2:230846688-230846710 AAAGGAATGAAGGGGGCGGGGGG + Intergenic
947536398 2:230942660-230942682 AAGGGACTTCAGGGGGCTGCAGG + Intronic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948049408 2:234968076-234968098 GATGGAATGAAGGGAGCAGCTGG + Intronic
948122678 2:235543036-235543058 GAGGGAATGACTGTGGCTCCCGG - Intronic
948243457 2:236457797-236457819 GAGGCAAGGAAGGGAGCTTCTGG + Intronic
948525890 2:238570564-238570586 CAAGGGATGCAGGGGGCTGCGGG + Intergenic
948856488 2:240732700-240732722 GAGGGGATGAGGGGGGATGAGGG + Intronic
948999835 2:241606984-241607006 GAGAAAATGAAAGGGGATGCAGG + Intronic
1168739234 20:174071-174093 GAGGGAAAGAAGGAGGATGTGGG - Intergenic
1168812705 20:716149-716171 GCGGGGATGAAGGAGGCTTCTGG + Intergenic
1169337369 20:4767499-4767521 GAGGCAAGGATGGGGGCTGGGGG - Intergenic
1170225775 20:13990694-13990716 GCCGGAATGAAGGCAGCTGCTGG + Intronic
1170880266 20:20290823-20290845 GAAGGCATGAAGGAGGCTGCAGG - Intronic
1171070280 20:22061886-22061908 GAGCTAAGGAAGAGGGCTGCAGG - Intergenic
1171119137 20:22553135-22553157 GAGGGGATGATGGGGCCTCCAGG + Intergenic
1172175528 20:32969881-32969903 GTGGGAAGGCAGGGGGCGGCCGG + Intergenic
1172196055 20:33092395-33092417 GATGGAAAGAAGGGGACTGAAGG - Intronic
1172251185 20:33480327-33480349 GAGGGAATGAAAAGCTCTGCGGG + Intergenic
1172777994 20:37418433-37418455 GAGGGAAGGAAGGGAGGTGGTGG + Intergenic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1174189064 20:48727389-48727411 GAGAGAGGCAAGGGGGCTGCAGG - Intronic
1174388035 20:50198397-50198419 GAGGGAATGAAATAGGCTCCTGG + Intergenic
1174473203 20:50776714-50776736 GAGGGAATGAAGGTTGCAGGTGG - Intergenic
1175052650 20:56169240-56169262 GAAAGAGTGAAGGAGGCTGCCGG - Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175334271 20:58184979-58185001 AATGAAATGAAGGTGGCTGCAGG - Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175623770 20:60473367-60473389 GGGAGAGTGAAGGAGGCTGCTGG - Intergenic
1175845258 20:62054879-62054901 GAGGGAATGTCGGTGGCTGGTGG - Intronic
1175862528 20:62157922-62157944 GAGGGAAGGAAAGGGTCTGGGGG - Intronic
1176051208 20:63120650-63120672 GAGGTCAGGAAGGGGGGTGCAGG - Intergenic
1176264016 20:64199228-64199250 CTGGGAAGGAAGGGGGCTGGCGG - Intronic
1176621617 21:9065384-9065406 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1177648679 21:23933324-23933346 GAGTGAATGCAGGGGCTTGCAGG - Intergenic
1179054359 21:37917016-37917038 AAGGGACTGAATGGGGCAGCAGG - Intergenic
1179471293 21:41612487-41612509 CAGGGAATAAAGGGGGCAGGCGG + Intergenic
1179509708 21:41864618-41864640 GAGGTAGTAAGGGGGGCTGCAGG - Intronic
1179908765 21:44437261-44437283 CAGGGGCTGCAGGGGGCTGCAGG - Intronic
1180457406 22:15522540-15522562 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1180956694 22:19744446-19744468 GAGGGAATGGGGAGGGCTGGTGG - Intergenic
1181047599 22:20222980-20223002 GAGGGAGAGAGGGAGGCTGCAGG + Intergenic
1181177562 22:21046241-21046263 AAGGGAAGGCAGGGGGCTGGAGG - Intronic
1181427923 22:22856125-22856147 GAAGGGCTGAAGGGGGCTGAAGG + Intronic
1182015886 22:27039344-27039366 GAGGGCATGGTGGAGGCTGCAGG + Intergenic
1182095167 22:27621085-27621107 GAGGGAAAGAATGGTGCTCCAGG - Intergenic
1183137597 22:35904080-35904102 GAGGGAATTAAGGGGTATGGGGG - Intronic
1183162914 22:36126798-36126820 GAGGGAAGGAAGGGGAATGGAGG - Intergenic
1183241100 22:36658926-36658948 GAGGGAAGGAAGGGGTGTGCAGG + Intronic
1183349576 22:37327416-37327438 GATGAAATGAAGGGGGGAGCAGG - Intergenic
1183393130 22:37557035-37557057 AAGGGAAGGAAGGGGACCGCAGG + Intergenic
1183427791 22:37748755-37748777 GAGGGCAGGACGGGGGCGGCTGG + Intronic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183585566 22:38751117-38751139 GAGGGAATCCCGGGGACTGCAGG + Intronic
1184103866 22:42355989-42356011 GAGGGAGAGAAGGGGGTTTCTGG + Intergenic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184661942 22:45969466-45969488 GAGGGCAGGTAGGGGACTGCAGG - Intronic
1184671466 22:46014102-46014124 GAGGGAGGGAAGGTGGCCGCGGG - Intergenic
1184738973 22:46416205-46416227 GTGGGAATGAAGGGGGCCACAGG + Intronic
1184878280 22:47289183-47289205 GAGGGAAGGTAGGGGGCAGAAGG + Intergenic
1185066372 22:48633663-48633685 GAGGGATTGGTGGGGGCGGCTGG + Intronic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
949180164 3:1119677-1119699 GAGGGAACTAAGGGGGGTGATGG - Intronic
949856575 3:8467284-8467306 GAGAGAATAAAGGGAGCTGGTGG - Intergenic
950167963 3:10816004-10816026 GCGGGAAGGACGGGCGCTGCAGG + Intergenic
950410192 3:12831167-12831189 GGATGAGTGAAGGGGGCTGCTGG - Intronic
950651049 3:14406874-14406896 GAGGGAATGATGGGGGAGGCAGG + Intronic
952296706 3:32068771-32068793 GAGGGAAAGAAGGAGGCTTTGGG - Intronic
953358258 3:42272646-42272668 AAGGGAGTGAAGAGGGCTGTGGG + Intergenic
954573703 3:51663061-51663083 GAGGAACTGACGGGGCCTGCTGG - Exonic
954798033 3:53171483-53171505 CAGGGAGTGAGGGGGGCTGGAGG - Intronic
955019548 3:55106003-55106025 GAATGAATGAGGGTGGCTGCTGG + Intergenic
955888970 3:63630641-63630663 GAATGAATGAAGGTGGCTGGAGG - Intergenic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
956723640 3:72139182-72139204 GTGGGAATAGAGGGGGCTGATGG + Intergenic
956726164 3:72158178-72158200 GTGGGAATGAAGAGGGCCACAGG + Intergenic
956787495 3:72654635-72654657 GAGTGAATGAATGTGGCTGCAGG - Intergenic
959904360 3:111694123-111694145 GAGGGATCAGAGGGGGCTGCAGG - Intronic
960789989 3:121418405-121418427 GAAGGGATGAAAGGCGCTGCTGG + Exonic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961378580 3:126482804-126482826 GAGGGAAGAAAGAGGACTGCAGG - Intronic
961386697 3:126526845-126526867 GAGGGAGCCAAGGGGGCCGCAGG - Intronic
961501055 3:127336374-127336396 GAGGGCATGAAAGCGGCTGTGGG - Intergenic
962072168 3:132044614-132044636 GAGGGGATGAAGGGGGAGGGAGG + Intronic
962372031 3:134828704-134828726 TGGGGATTGAAGGAGGCTGCAGG + Intronic
963032615 3:140993749-140993771 GAGGGAATGGAAGGGGAGGCAGG - Intergenic
964137559 3:153362001-153362023 GAGCTGATGAAGGGGGCAGCAGG + Intergenic
966853459 3:184178286-184178308 GAGGGAATGAAAAAGGATGCAGG - Intronic
967047712 3:185752976-185752998 GAGAGAATGCAGGGGGCTGAGGG + Intronic
967318384 3:188171944-188171966 GAGGGCATGATGTGGGCTGGTGG + Intronic
968876177 4:3269085-3269107 GAGGGGAAGATGGGGGCGGCAGG + Intronic
969182642 4:5454028-5454050 GAGGGAATCTATGGGGCTGCTGG - Intronic
969248394 4:5951329-5951351 GAGGGAATGAAGGGGGGTGGTGG + Intronic
969254151 4:5991146-5991168 GAGGGCATGGAGGGTGCTGTGGG - Intergenic
969480739 4:7445615-7445637 GAGGCCAGGATGGGGGCTGCAGG + Intronic
969832982 4:9813472-9813494 AAGGGAATGAATGTGGCTCCAGG - Intronic
969872709 4:10114981-10115003 GAGGGAATGAAGGGGTCTCTGGG - Intronic
969951536 4:10841457-10841479 GTGGGAGTGAATGGGGCTGGAGG + Intergenic
971221620 4:24712778-24712800 AAGGGTATGAGTGGGGCTGCAGG + Intergenic
971287885 4:25307932-25307954 GAGGAAGTCAAGGGGGTTGCGGG + Intergenic
972390778 4:38610901-38610923 GTGGGAATGACGGGGGTTGGGGG - Intergenic
972749141 4:41971479-41971501 GAGGGTATGAAGGGGATTGTTGG + Intergenic
973123049 4:46546557-46546579 CAGGGAATGAATGGAGCTGGAGG - Intergenic
974126783 4:57706672-57706694 AATGGAAGGAAGGGGGCAGCTGG + Intergenic
974187121 4:58459414-58459436 GAGGGAAGGAAGGGCTCTCCAGG - Intergenic
975473450 4:74795082-74795104 CAGGGAATGGATGGGACTGCAGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
978618034 4:110615006-110615028 GAGGGATGGAAGGGGGTGGCGGG + Intergenic
979341073 4:119525007-119525029 GAGGAAATAAAGGGGCCTGATGG - Intronic
981384007 4:144106242-144106264 GAGGGACTGAAGAAGGATGCAGG - Intergenic
984164308 4:176288960-176288982 GAGGGAATGAACCAAGCTGCTGG - Intergenic
984479952 4:180287353-180287375 GTGGGAATTATGGGAGCTGCAGG + Intergenic
985956707 5:3271107-3271129 AAGGGAGGGAAGGGGGCTGCTGG - Intergenic
986341264 5:6791273-6791295 GAGGGGATGAATGAGGCTGTGGG - Intergenic
986781084 5:11066437-11066459 GAGGGAGTGAGGGGGGCTGTAGG - Intronic
988563088 5:32298339-32298361 TAGGGAAAGAAGGGTGCTGTTGG + Intronic
988680638 5:33481033-33481055 GAGGGAATGAAGGGGAGGGGAGG - Intergenic
989285634 5:39696242-39696264 GAGGGAATGAAGGGGGTGGAAGG - Intergenic
989351137 5:40488010-40488032 GATGGAACCAAGGGGGCTGCAGG - Intergenic
989543598 5:42646609-42646631 AAGGGAATGAATGGTTCTGCAGG + Intronic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
992636677 5:78731291-78731313 GAGAGAATAGAGGGGACTGCAGG + Intronic
997577202 5:134989584-134989606 GAGAGAGAGAAGGAGGCTGCCGG - Intronic
998650795 5:144119100-144119122 GAAGGAGTGAAGGAGGCTGGTGG + Intergenic
999396582 5:151233127-151233149 CAAAGAATGAAGTGGGCTGCTGG - Intronic
999719037 5:154385130-154385152 GGGGGAATGGAGGTTGCTGCTGG + Intronic
1000438480 5:161241516-161241538 GAGGGAATGAAGGAAGCTTTGGG - Intergenic
1000871360 5:166581299-166581321 GAGAGAAGAAAAGGGGCTGCAGG + Intergenic
1001102033 5:168822363-168822385 GAGCTAATAAAGGGGACTGCAGG + Intronic
1001111899 5:168903591-168903613 GAGTGAAGGACGGGGGCAGCAGG + Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001398120 5:171431135-171431157 GAGGGAGTGATGGAGGCTGCTGG + Intronic
1001700696 5:173704812-173704834 GAGGCAATGAAGGAGGCTGGAGG + Intergenic
1002092073 5:176811580-176811602 AAGGGAATGAGGTGGGCTGAGGG - Intronic
1002417421 5:179127774-179127796 GTGGGCAGGAAGGGGGGTGCTGG - Intronic
1002456099 5:179345894-179345916 GAGGGAATGAAAGGGGAGGGGGG + Intergenic
1002720703 5:181259967-181259989 GAGGGAATGTGGGGGGATGAAGG - Intronic
1002769751 6:280975-280997 GGGGGACTGAAGGGTGCTGGTGG - Intergenic
1002999781 6:2320034-2320056 GATGGGATCAAGGGGGCTGTAGG + Intergenic
1003121421 6:3321880-3321902 GAGGGAAGACAGGGGCCTGCTGG + Intronic
1003530067 6:6929661-6929683 GAGTGAATGAATGGCTCTGCTGG + Intergenic
1003548938 6:7084959-7084981 GATGGGAAGAAGAGGGCTGCTGG - Intergenic
1004015468 6:11728148-11728170 AATGGAATGAAGGAGGCTGAAGG - Intronic
1004531179 6:16457018-16457040 GAGGGAAGGAAGGGATCTCCAGG - Intronic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007608349 6:43132295-43132317 GAGGATATGCAGAGGGCTGCAGG + Intronic
1008850326 6:56014975-56014997 GAGGGAATGAAGGAGGATTGGGG + Intergenic
1009032826 6:58081123-58081145 GATGGGATGATGGGGGATGCTGG - Intergenic
1009208442 6:60832897-60832919 GATGGGATGATGGGGGCTGCTGG - Intergenic
1010465476 6:76163018-76163040 CAGAGAATGTAGGGGGCTGCTGG + Intergenic
1010803827 6:80211676-80211698 GAGTGAATGAAGGGGCTTGCTGG - Intronic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1012932025 6:105327303-105327325 GAGGGAATGGGGGGAGGTGCAGG + Intronic
1012983268 6:105851853-105851875 GCTGGAATAAAGGGGGCAGCTGG - Intergenic
1012984794 6:105864385-105864407 GGGGGCATGGAGGGGGCTTCGGG - Intergenic
1014038152 6:116791937-116791959 TAGGAAATGAAGGGAGCTTCAGG + Intergenic
1015803397 6:137083791-137083813 GAGGAAATGAAGAGGGATTCAGG + Intergenic
1016994077 6:149948486-149948508 GATGGAGTGGAGGGGCCTGCAGG - Intronic
1019336468 7:485209-485231 GAGGGAATGAAGGAGGGAGGAGG + Intergenic
1019361399 7:605987-606009 GAGGGAAACAAGGGTGATGCTGG - Intronic
1019397536 7:830115-830137 GAGGGAGTGAATGAGACTGCAGG + Intronic
1019911341 7:4102229-4102251 GAGGGACAGATGGGGGCTTCTGG - Intronic
1022221614 7:28319584-28319606 GAGGTGATGAAGGTGGATGCAGG + Intronic
1022556726 7:31305667-31305689 CAGGGAAGAAAGGGGGCTTCAGG + Intergenic
1022721897 7:32948921-32948943 GAGAGAAAGACGGGGGATGCTGG + Intergenic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1023965621 7:44961908-44961930 GAGGGGCTGAAGGAGGCTGAGGG + Intergenic
1024220264 7:47281539-47281561 GAGGGGCTGCAGGTGGCTGCAGG - Intronic
1025210104 7:57015436-57015458 GAGAGAGGGAAGGGGGCTCCAGG - Intergenic
1025661847 7:63561415-63561437 GAGAGAGGGAAGGGGGCTCCAGG + Intergenic
1026436781 7:70406198-70406220 GAAGGAAGGAAGGGGGTGGCAGG - Intronic
1028846343 7:95484417-95484439 GAGGACATAAAGGGGGCTTCAGG + Intronic
1029566627 7:101342834-101342856 GAGGGACTGGAGGGGACAGCAGG + Intergenic
1029896606 7:103990046-103990068 GAGGGAAGGAGAGGGGCGGCAGG + Intergenic
1031803885 7:126283669-126283691 AAGGAAATGAAGGGGGAGGCAGG - Intergenic
1032159122 7:129497232-129497254 CAGGGAATGATGGGGGCTAAGGG + Intergenic
1032284204 7:130528566-130528588 GAGAGAATGCAGGAGGGTGCAGG + Intronic
1032513621 7:132491360-132491382 GAGGGAGTGGAGGAGCCTGCTGG - Intronic
1032586385 7:133151095-133151117 GCAGAAGTGAAGGGGGCTGCTGG - Intergenic
1033223727 7:139544881-139544903 AAGGCAAAGAAGGGGGATGCAGG - Exonic
1033659950 7:143396305-143396327 GCTGGAAGGAAGGGGCCTGCTGG + Intronic
1033716256 7:144005705-144005727 GAGGGCGGGAAGGGGGGTGCGGG - Intergenic
1034423076 7:150999278-150999300 CAGCCACTGAAGGGGGCTGCGGG - Exonic
1034438889 7:151076722-151076744 GGGGGCCTGAAGGGGGCTGAGGG - Exonic
1034474911 7:151276468-151276490 GAGGGAAGGAGGGGAGATGCAGG + Intronic
1034498352 7:151435113-151435135 GAGGGGATGCAGGGGGCAGAGGG - Intronic
1034534908 7:151720662-151720684 GAGGGGATGGAGGGGGATGGAGG + Intronic
1034534930 7:151720729-151720751 GAGGGGATGGAGGGGGATGAAGG + Intronic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035062568 7:156080037-156080059 GAGGCAATGACGGGGGTGGCGGG - Intergenic
1035086499 7:156263747-156263769 GAGGAAGTGAGGGGTGCTGCGGG + Intergenic
1035994587 8:4531992-4532014 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994594 8:4532027-4532049 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994645 8:4532388-4532410 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994662 8:4532497-4532519 GAGTGACTGAATGGGGGTGCGGG - Intronic
1035994674 8:4532569-4532591 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994684 8:4532641-4532663 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994696 8:4532710-4532732 GAGTGACTGAATGGGGGTGCAGG - Intronic
1035994702 8:4532745-4532767 GAGTGACTGAATGGGGGTGCAGG - Intronic
1036391551 8:8328333-8328355 GGGGGAGTGGAGGGGGCTGCTGG + Exonic
1036667845 8:10759272-10759294 GAGGGAACGATGGGAGGTGCAGG + Intronic
1037479260 8:19289083-19289105 GAGGGAAAGAAGGGGATTGGAGG + Intergenic
1037787903 8:21913200-21913222 AAGGGAATGGAAGGGGCAGCTGG - Intronic
1037849005 8:22310687-22310709 GGGAGAATGGAGGGGGCTTCTGG - Intronic
1038026152 8:23592568-23592590 GAGAGAATGAAGAGGCTTGCTGG + Intergenic
1039454756 8:37699150-37699172 GAGGGAATGAAGGGGGAAGAGGG - Exonic
1041661924 8:60409274-60409296 GAGGAAATGAAGGGCACTGGAGG - Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1048314116 8:133349579-133349601 AAGGGAAGGAAGGGGGCAGGGGG + Intergenic
1048337355 8:133512965-133512987 GAGGGGAGGAAGGGGCCTGATGG + Intronic
1048346547 8:133580193-133580215 GAGGGAAGGAGAGGGGCTTCGGG - Intergenic
1049110252 8:140637722-140637744 GAGGGTAGGGATGGGGCTGCAGG - Intergenic
1049184473 8:141242385-141242407 GCGGGAATGAACGTGGCTCCTGG + Intronic
1049194413 8:141307818-141307840 GGGGGAATGAGGGAGGCTGCAGG + Intronic
1049255944 8:141613940-141613962 GATGGAAGGAAGGCGCCTGCTGG + Intergenic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049430006 8:142557767-142557789 GAGGGGATGCTGGGGGCTGGTGG - Intergenic
1049583447 8:143422768-143422790 GGGGGCATGAAGGGGTCGGCGGG - Intronic
1049803888 8:144530299-144530321 GGGGGAGTGGAGGGGGCTCCAGG + Exonic
1050306225 9:4308400-4308422 GAAGGAAGGAAGGGCGCTGGAGG + Intronic
1052231077 9:26153448-26153470 AAGGGAAGGAAGGGGGGTGAGGG + Intergenic
1053071379 9:35104060-35104082 GAGGGTGTGAAGGGGGATGGAGG - Intergenic
1053276660 9:36788331-36788353 AGGGGAATGAACGGGGCTACAGG + Intergenic
1055973061 9:81930732-81930754 GAGAGAATTAAGGGGGGTGGTGG - Intergenic
1055974814 9:81945824-81945846 GAGAGAATTAAGGGGGGTGGTGG - Intergenic
1055979857 9:81991050-81991072 GAGAGAATTAAGGGGGGTGGTGG - Exonic
1056419238 9:86407529-86407551 TGGGGAATGCAGGGGGGTGCTGG + Intergenic
1056900242 9:90592395-90592417 GAAGGGATGAAGGAGGGTGCTGG - Intergenic
1057134916 9:92680703-92680725 GAGGGAAGGAAGGGGGTGCCTGG + Intergenic
1059354398 9:113687808-113687830 GAGGGAAGGAAGGGGGAAGAGGG - Intergenic
1060519997 9:124288887-124288909 GGGGCAATGAAGGGGGCTGCAGG - Intronic
1060890212 9:127183355-127183377 GGGGGCATGGAAGGGGCTGCAGG - Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1060977676 9:127774555-127774577 GAGGGGCTGAAGAGGGCTGGCGG + Intronic
1061035758 9:128113602-128113624 GGGGGAATGAAGGAGGCAGATGG + Intergenic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061455845 9:130696907-130696929 GGAGGACTGGAGGGGGCTGCGGG + Intronic
1061708643 9:132472088-132472110 GATGGAATCATGGGGGCGGCGGG - Intronic
1061778870 9:132984300-132984322 GCGGGAAGGAAGGGGGGTGTGGG + Intronic
1061920632 9:133780464-133780486 AAGGGAATGAGGCGGGCAGCTGG + Intronic
1061995030 9:134178835-134178857 ACGGGAATGGAGGGGGCTGGCGG + Intergenic
1062495895 9:136831510-136831532 GAGGGACGGGCGGGGGCTGCAGG + Intronic
1185778854 X:2828980-2829002 GGGGGGCTGTAGGGGGCTGCAGG + Intronic
1186429242 X:9490286-9490308 GATGGAATCAAGGAAGCTGCAGG - Intronic
1186429753 X:9495021-9495043 TAGGAATTGAAGGGGGCTGTTGG + Intronic
1188024099 X:25190161-25190183 GAGGGAAGGGAGGGGGATGGTGG + Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1190722524 X:53161906-53161928 GAGGGAATCAATGGGCCTCCGGG + Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1192234500 X:69287124-69287146 GAGGGACTGAGGAGGGCGGCTGG - Intergenic
1192237596 X:69305916-69305938 GAGGGAGGGGAGGGGGCTCCAGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193447257 X:81619551-81619573 GGGGGAATGAAAGGGGTGGCTGG - Intergenic
1195684180 X:107570728-107570750 GATGGAATCAAGGGGCCTGGAGG - Intronic
1196127561 X:112115464-112115486 GAGGGAAGGAAGGGATCTCCAGG + Intergenic
1196339716 X:114583030-114583052 GAGGGAACGAAGGGGCGAGCGGG - Intergenic
1196410351 X:115411921-115411943 GAGGGAATGAAGTAAGCAGCTGG - Intergenic
1196634994 X:117992096-117992118 GAGGGAATGAGGCAGGCTGGAGG + Intronic
1197331984 X:125164272-125164294 GAGGGATTGAAAGTGGCTGGAGG - Intergenic
1199886327 X:152025159-152025181 TATGGAATAAAGGGGGCTGGAGG - Intergenic
1201140456 Y:11023257-11023279 GAGGGGATGGAGTGGGCTGGCGG - Intergenic