ID: 924385174

View in Genome Browser
Species Human (GRCh38)
Location 1:243493127-243493149
Sequence CTCAAACAAAAGACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924385174_924385186 29 Left 924385174 1:243493127-243493149 CCCTGGCCTGTCTTTTGTTTGAG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 924385186 1:243493179-243493201 CTTGAGAGGCAGGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 48
4: 343
924385174_924385181 15 Left 924385174 1:243493127-243493149 CCCTGGCCTGTCTTTTGTTTGAG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 924385181 1:243493165-243493187 CGCACTCTCGCCCTCTTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 35
924385174_924385182 19 Left 924385174 1:243493127-243493149 CCCTGGCCTGTCTTTTGTTTGAG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 924385182 1:243493169-243493191 CTCTCGCCCTCTTGAGAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 323
924385174_924385184 25 Left 924385174 1:243493127-243493149 CCCTGGCCTGTCTTTTGTTTGAG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 924385184 1:243493175-243493197 CCCTCTTGAGAGGCAGGCCCTGG 0: 1
1: 0
2: 3
3: 31
4: 246
924385174_924385187 30 Left 924385174 1:243493127-243493149 CCCTGGCCTGTCTTTTGTTTGAG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 924385187 1:243493180-243493202 TTGAGAGGCAGGCCCTGGCTGGG 0: 1
1: 0
2: 2
3: 50
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924385174 Original CRISPR CTCAAACAAAAGACAGGCCA GGG (reversed) Intronic
902091710 1:13908945-13908967 CGAAAACAAAAGGCAGCCCAAGG - Intergenic
902860554 1:19242231-19242253 CACCAACAAGAGACAGGCCTGGG + Intronic
905030864 1:34883806-34883828 CACAAACACAAGACATCCCAAGG + Intronic
905642025 1:39596654-39596676 CTCAAAGAAAAGCCAGCACAAGG - Intergenic
906522548 1:46475993-46476015 CAAAAACAAAACAAAGGCCATGG + Intergenic
907167788 1:52430283-52430305 CTCAAACAAAAAAAAGATCAAGG - Intronic
907169631 1:52450411-52450433 ATCAAACAAGAGACAGTTCATGG - Intronic
908181189 1:61607533-61607555 TTCAAACACAAAGCAGGCCAAGG + Intergenic
908199958 1:61784313-61784335 CTCACACAGAAGACAGGTTATGG + Intronic
908365966 1:63424139-63424161 CTCAAAAAAAAAATAGGCAAAGG - Intronic
908669889 1:66534198-66534220 TTAAGCCAAAAGACAGGCCATGG - Intronic
908924202 1:69233672-69233694 AGAAAACAAAAGAGAGGCCATGG - Intergenic
909369993 1:74872463-74872485 CTCAAACCCATGACAGGCCCCGG + Intergenic
910060902 1:83090409-83090431 CTGAAACTAAAGCCAAGCCAAGG + Intergenic
910613820 1:89174901-89174923 ATCAGACAAAAAACAAGCCATGG - Intronic
912597813 1:110896843-110896865 CTTGAATAAAAGAGAGGCCAGGG + Intronic
915331467 1:155115299-155115321 CTCAAACCATAAACAAGCCAAGG + Intergenic
915657259 1:157371445-157371467 CTGAAACAAAAGGCAGAGCAGGG - Intergenic
915671734 1:157494944-157494966 CTGAAACAAAAGGCAGAGCAGGG + Intergenic
916321170 1:163505889-163505911 CTCAAACAAAAGCCATTACATGG + Intergenic
918466752 1:184828485-184828507 CTCATAGAAAAAAGAGGCCAGGG - Intronic
919448502 1:197740375-197740397 TTCAAATAAAAGACTTGCCAGGG - Intronic
919989428 1:202698879-202698901 CCCCTACAAAAGACAGGCCAAGG + Intronic
920524587 1:206657436-206657458 ATCTAACAAAAGCTAGGCCATGG + Intronic
922644520 1:227273295-227273317 CTCAAAAAAAAGGCCGGGCATGG + Intronic
923330737 1:232922137-232922159 CTCAAAGAAAAGACCGTCTAAGG - Intergenic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1063049365 10:2430003-2430025 CTAAAACAAATAACAGGGCATGG + Intergenic
1063783691 10:9355859-9355881 TTCAAGCAAAAGAAAGGGCAAGG + Intergenic
1065507898 10:26447719-26447741 CTCAAAAAAAAGAAAAGTCATGG - Intronic
1065801206 10:29354382-29354404 CTCACACAAAGGACAGGCAAAGG - Intergenic
1067374785 10:45717821-45717843 CTCAAACACAAAAAAGTCCAAGG + Intergenic
1067378943 10:45754729-45754751 CTCAAACACAAAAAAGTCCAAGG - Intronic
1067882598 10:50059459-50059481 CTCAAACACAAAAAAGTCCAAGG + Intergenic
1067886645 10:50095391-50095413 CTCAAACACAAAAAAGTCCAAGG - Intronic
1068458639 10:57295005-57295027 TTCAAACCTAAAACAGGCCAAGG + Intergenic
1068531551 10:58193263-58193285 CTCAATCAAAATACAGACGAAGG + Exonic
1068941435 10:62684815-62684837 CTCTAACTAAAGCCAGGGCAGGG + Intergenic
1070145250 10:73769233-73769255 CTAAAAGAAGAGACAGGGCACGG + Intronic
1071847953 10:89538987-89539009 TTCTTACTAAAGACAGGCCAAGG - Intronic
1072180895 10:92978892-92978914 CCAAAACCAAAGACAGGGCACGG - Intronic
1072638394 10:97192581-97192603 CTTAAACAACTGACAAGCCAGGG - Intronic
1074247796 10:111712795-111712817 CCCAAACAAAACTCAGGCAAAGG - Intergenic
1074297865 10:112207728-112207750 CTCAAGCAAGAGACAGGCAGAGG + Intronic
1074505605 10:114067721-114067743 CTCAAAAAAAAGGCTGGGCATGG - Intergenic
1074844139 10:117382056-117382078 CTCAAAAAAAAAATAGGCAAAGG - Intergenic
1074931859 10:118135292-118135314 CTCCAATAAAAGAGAGACCAAGG + Intergenic
1076097322 10:127742045-127742067 CACACACACAAGACAGGGCAGGG - Intergenic
1076137964 10:128057877-128057899 CTCAAAGGAAAGGAAGGCCATGG + Intronic
1076395329 10:130134779-130134801 CTACAACATGAGACAGGCCACGG + Intergenic
1077084326 11:740905-740927 CTCAAAAAAAAAGCTGGCCATGG + Intergenic
1077211514 11:1372845-1372867 CTCACACCAGAGACAGGTCAAGG + Intergenic
1078742638 11:14081541-14081563 CCCAAACAAAAGGCAGGCATAGG - Intronic
1080333696 11:31172485-31172507 CTCAAACAACATGGAGGCCAGGG + Intronic
1080672864 11:34396995-34397017 CTCAAACAAAAGCCTGGGTATGG - Intergenic
1080819727 11:35793770-35793792 CAAAAACAAGAGCCAGGCCATGG + Intronic
1081882819 11:46468496-46468518 CTTAAAGAAAAGGAAGGCCAGGG + Intronic
1084005651 11:66322208-66322230 CAAAAACCAAAGACAGGGCAGGG + Intergenic
1086775843 11:90831867-90831889 CTCAAGCAAATCACAGGCCTTGG + Intergenic
1087224923 11:95588130-95588152 CTAAAACAAAAGACAGAGTATGG + Intergenic
1088371495 11:109093167-109093189 CTGAAAAATAAGACATGCCATGG - Intergenic
1088578491 11:111295701-111295723 CTCAAAAAAAAAAAAAGCCAGGG + Intergenic
1088756003 11:112885844-112885866 CTCAAGGAACAGACAGGCTAAGG + Intergenic
1089153500 11:116383622-116383644 CTAAGAAGAAAGACAGGCCAGGG + Intergenic
1089417590 11:118305155-118305177 CTAAAGAAAAAGATAGGCCACGG + Intronic
1090225382 11:125068799-125068821 GCTAAACAAAATACAGGCCAGGG + Intronic
1090602196 11:128384757-128384779 CTCAAAAAAAATATAGGCTAGGG + Intergenic
1092035148 12:5327980-5328002 CTTAAAGAAAAAACAGGCCGAGG + Intergenic
1092053487 12:5490156-5490178 CCCAAAGAAAATACAGGCCCTGG - Intronic
1092764815 12:11842970-11842992 CTAAAACAAGAGGCAGGCCAGGG + Intronic
1092815685 12:12310611-12310633 CTCAAAAAAAAAACAAACCACGG - Intergenic
1093492850 12:19725126-19725148 CTCAAGCAAAACTCAGGCAAAGG - Intergenic
1093546750 12:20357554-20357576 CCCAAACCAAATTCAGGCCATGG + Intergenic
1094550375 12:31445468-31445490 CTCAAACAAAACACCTGCCTTGG - Intronic
1097398111 12:59100829-59100851 CTCACACACACAACAGGCCAGGG - Intergenic
1097399061 12:59107824-59107846 CTCACACACACAACAGGCCAGGG + Intergenic
1097503946 12:60440446-60440468 CTCTCTCTAAAGACAGGCCAGGG - Intergenic
1097776118 12:63648424-63648446 CTCAAAAAAAAAAAAGCCCAGGG - Intronic
1100879257 12:98997996-98998018 CCAAACCAGAAGACAGGCCAAGG - Intronic
1101704465 12:107209000-107209022 CTCAAAGAAAAGCCAGTTCAAGG - Intergenic
1101774983 12:107785407-107785429 CTCAAAAAAAAAAAAGACCAAGG + Intergenic
1102112805 12:110377714-110377736 TTCAGACAAAGGGCAGGCCACGG + Intronic
1102340520 12:112117825-112117847 CTCAAAAAAAAAAGAAGCCAGGG + Intergenic
1103847104 12:123909156-123909178 CTCAACCAAAAGACAGTCCCTGG - Intronic
1104003033 12:124872583-124872605 CTCAAAAAAAAGTAAGGCCAGGG - Intronic
1104285358 12:127419675-127419697 CTCCAAGAAAAGGGAGGCCAGGG + Intergenic
1105045987 12:133003545-133003567 CTAAAAGAAAAGGGAGGCCAGGG - Intronic
1105653793 13:22410976-22410998 CTCAAACAAATGAATGTCCAAGG - Intergenic
1107817944 13:44261059-44261081 AACAAGCAAAAGTCAGGCCAAGG - Intergenic
1108511567 13:51160847-51160869 CTGAAATAAAAAACAGGGCAAGG + Intergenic
1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG + Intergenic
1109041050 13:57337755-57337777 CTCAAATAAGAGAAAGACCATGG - Intergenic
1109237904 13:59847076-59847098 CTCAAAAAAAAGAAAGACAAAGG + Intronic
1110690757 13:78428018-78428040 CTCAAACTAAGGACAGGAGATGG - Intergenic
1110727578 13:78843141-78843163 CACACACCAAGGACAGGCCATGG - Intergenic
1110952659 13:81515942-81515964 CTCAAAAAAAAAAAAGGCTAGGG - Intergenic
1111045392 13:82807239-82807261 CCCAAATAAAAGACACACCATGG + Intergenic
1111742106 13:92217441-92217463 CTCCTACTGAAGACAGGCCAGGG - Intronic
1113045085 13:106146828-106146850 CTCAATCCAAAGAGAGGGCATGG - Intergenic
1114288960 14:21272035-21272057 AACAAACAAAAGACAGGGCCTGG - Intergenic
1115599097 14:34938510-34938532 CTCAAAGAAAAAAAAGGGCAGGG - Intergenic
1116191244 14:41670932-41670954 CTCAAAGAAAAGTCAGTTCAAGG - Intronic
1118178686 14:63469339-63469361 CTCAAAAAAAGTACAGTCCAGGG + Intronic
1119164569 14:72481361-72481383 AGCAAACAAAGGGCAGGCCAAGG + Intronic
1119589439 14:75871664-75871686 AACAAACAAACCACAGGCCACGG - Intronic
1120146256 14:80982111-80982133 CCAAAGCAAAAGACAAGCCAGGG + Intronic
1123411234 15:20061729-20061751 CTGATACCAAAGACAGGCAAAGG + Intergenic
1123520580 15:21068840-21068862 CTGATACCAAAGACAGGCAAAGG + Intergenic
1124576631 15:30914658-30914680 GTCAAAAAAAATACAGGCCGAGG - Intronic
1125113918 15:36066871-36066893 CCCAAACAAAACTCAGGCAAAGG - Intergenic
1126731253 15:51685526-51685548 ATCACAGAGAAGACAGGCCAAGG + Intronic
1128722582 15:69961605-69961627 CTCAAAGAATAGGGAGGCCAAGG - Intergenic
1129154039 15:73706632-73706654 CCGAAGCAAAATACAGGCCAAGG - Intronic
1129415409 15:75374578-75374600 CTCAAACAAATTACAAACCATGG + Intronic
1130014724 15:80177713-80177735 CTCCTAAAAGAGACAGGCCATGG - Intronic
1130546538 15:84860593-84860615 CTCCTACAAGAGACAGGCTAAGG + Intronic
1131566615 15:93491652-93491674 CTAGAACAAAACACAAGCCAAGG - Intergenic
1132093463 15:98964829-98964851 CACTAACAACAGTCAGGCCAAGG + Intergenic
1133192231 16:4142589-4142611 CACACACACAAGACAGGGCAGGG - Intergenic
1134417445 16:14056599-14056621 CTCCAAAAAAAGAGAGACCAGGG - Intergenic
1136688772 16:32012596-32012618 CTCAACCAAAAGAAAGCCAAAGG + Intergenic
1136789369 16:32956117-32956139 CTCAACCAAAAGAAAGCCAAAGG + Intergenic
1136852206 16:33621109-33621131 CTCAAAAAAAAAAAAGGGCAGGG - Intergenic
1136880444 16:33897819-33897841 CTCAACCAAAAGAAAGCCAAAGG - Intergenic
1137371076 16:47906304-47906326 CTCAAAAAAAAAAAATGCCAAGG - Intergenic
1137481409 16:48854730-48854752 AACAAACAAAAGACTGGGCACGG + Intergenic
1138269752 16:55686773-55686795 CTCAAACAAAATGCAGACCAGGG + Intronic
1138410936 16:56839750-56839772 CTCACAGAAAAGCCAGGCCAAGG - Intronic
1139624570 16:68175977-68175999 CTCAAAAAAAAGAAAAGCAAGGG - Intronic
1139924354 16:70478042-70478064 CTAAAACAAAACTCAGGCCTTGG + Intronic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1140655916 16:77139812-77139834 CTCAAGTAAGAGACACGCCAAGG + Intergenic
1140747789 16:77996433-77996455 CTCAAACCCAAGACAAGCCCTGG + Intergenic
1203091565 16_KI270728v1_random:1217612-1217634 CTCAACCAAAAGAAAGCCAAAGG + Intergenic
1142955894 17:3521778-3521800 TTTAAAACAAAGACAGGCCAGGG + Intronic
1143363504 17:6390121-6390143 CAGAAGCAAAAGACAGCCCATGG - Intergenic
1144041409 17:11414215-11414237 CCTAAAATAAAGACAGGCCAGGG + Intronic
1146150648 17:30467057-30467079 CGCAAATAAAAGACAGGGCAGGG - Exonic
1147151623 17:38518782-38518804 CTCAACCAAAAGAAAGCCAAAGG + Intergenic
1147538651 17:41337240-41337262 CCCAAACAAAACGCAGGCCTGGG - Intergenic
1149706020 17:58695770-58695792 CTCAAAAAAAAAAGAGGCCGGGG + Intronic
1150125438 17:62631907-62631929 CTCAAATAAAGAATAGGCCATGG - Intronic
1151791808 17:76310462-76310484 CAAAAAAAAAAAACAGGCCAGGG - Exonic
1158285563 18:55877534-55877556 CTCAAACAAAGGACTTGCAAGGG - Intergenic
1158477371 18:57792189-57792211 TTCAAAAAAAGCACAGGCCATGG - Intronic
1158524301 18:58198437-58198459 CTAAAACAAAATTCGGGCCAGGG - Intronic
1159392995 18:67819061-67819083 CACAAAGAAAAGAGAGGGCAGGG - Intergenic
1159512469 18:69413911-69413933 TTCAACCAGAAGACAGGCAAAGG + Intronic
1161824971 19:6557308-6557330 CAGAAAAAAAAAACAGGCCATGG - Intergenic
1162981986 19:14246436-14246458 CTCAAAAAAAAAAAAGGCCAGGG + Intergenic
1163703308 19:18797981-18798003 CTCAAGAAAAAGAAAGGCCCAGG + Intergenic
1164922111 19:32095979-32096001 CTCAAATAAAAGAAAGGTGAGGG + Intergenic
1165669773 19:37665779-37665801 CTCAAACAATACACCAGCCATGG + Intronic
1166370565 19:42298194-42298216 CTCAAAAAATAAATAGGCCAAGG + Intronic
1167286274 19:48600334-48600356 CTCAAACAAAAAAAAGGACTTGG - Intergenic
1167496369 19:49821280-49821302 CTCAAAAACAAGAGAGGCCTGGG - Intronic
927931667 2:27049743-27049765 CACATGCAAAAGACAGGCGAAGG + Intronic
928938805 2:36707194-36707216 CTCACATAACAGACAGTCCAGGG + Intronic
929719271 2:44350959-44350981 CTCAAACAAAAAAAAAGCCAGGG - Intronic
933275814 2:80283246-80283268 CTCAAACAAACTAAAGGTCAGGG + Intronic
933794909 2:85911817-85911839 CTCAAAAAAAAGGCCGGGCACGG - Intergenic
933871452 2:86569272-86569294 CTCAGTGAAAAGACAGGCTAGGG + Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934700055 2:96431626-96431648 CCCAAACAAAACTCAGGCAAAGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937274694 2:120676141-120676163 GTTAAAGAAAAGACAGGGCAGGG + Intergenic
938783459 2:134605685-134605707 CTCAAAAAAAGGAAAGGCAAGGG + Intronic
939005178 2:136778536-136778558 TTCACACAAAAGACAAGCCAGGG + Intronic
939214371 2:139217449-139217471 CACACATAAAAGCCAGGCCAAGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
939668420 2:144979185-144979207 CTTAACCAAAAGACAGGAGAAGG - Intergenic
940396137 2:153195250-153195272 CCCAAACAAGAGTCAGGCAAAGG - Intergenic
940684139 2:156825096-156825118 CACAAACAAAAAACAGGGCAAGG - Intergenic
941251097 2:163163679-163163701 CACATACAAAAGACAAGACAAGG - Intergenic
942271035 2:174275469-174275491 AACAAACAAAAGACAGCTCAGGG + Intergenic
944092184 2:195924295-195924317 CAACAACAAAAGACAGCCCAGGG + Intronic
944326163 2:198406544-198406566 TTCAAACAAGAGACATGCCTAGG + Intronic
945908888 2:215624017-215624039 CTCAAAGAAAAGAGAGGACGAGG + Intergenic
946776039 2:223142286-223142308 TTCAATCAAAGGACAGGCCGAGG + Intronic
948028291 2:234796149-234796171 TCAAAACAAAAGACAGACCAAGG + Intergenic
1170020239 20:11829577-11829599 CTCAAACAAAATAAAGGACTTGG + Intergenic
1171002964 20:21433436-21433458 GTCAATCAGAAGACAGGCCCAGG - Intergenic
1171135982 20:22694705-22694727 TGCAAAGAAAAGACAGGCCATGG - Intergenic
1172715615 20:36961264-36961286 CACACACCAAAGAGAGGCCATGG + Intergenic
1175546801 20:59783439-59783461 CTCAAACAAAAAAAAGGGCCGGG - Intronic
1177370185 21:20192811-20192833 CTCTAACAAAATATTGGCCATGG + Intergenic
1179110783 21:38443246-38443268 CTCAAACAAGGGCCAGGACATGG + Intronic
1181061207 22:20282910-20282932 CACTAACAAAAGATGGGCCAGGG - Intronic
1181994426 22:26864216-26864238 CACAAACAAAAAGCAGGTCAGGG - Intergenic
1182258593 22:29056099-29056121 CTCAAAAAAAAAAAAGGCAATGG - Exonic
1182684520 22:32111310-32111332 CACAGACAAAAGGAAGGCCACGG - Exonic
1182708340 22:32304129-32304151 CTCAAAAAAAAGAAAGGAAAAGG - Intergenic
1183331306 22:37223301-37223323 CTTAAAAAAATGACAGGCCCAGG - Intergenic
1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG + Intronic
1184751437 22:46488658-46488680 CTCAAAAAAAAAAAAGGGCAGGG - Intronic
949896537 3:8771059-8771081 ATAAAACAAAAGACAGGAAATGG - Intronic
953088607 3:39700351-39700373 CTTATCCAAAAGACAGGCAATGG + Intergenic
953931215 3:47006745-47006767 CTAAAAAAAAAGTCAGGCCTGGG - Intronic
954469922 3:50684478-50684500 CTCAAGAAAGAGAAAGGCCAAGG - Intronic
954692809 3:52404713-52404735 CACAAGCCAAGGACAGGCCATGG - Intronic
954921061 3:54191531-54191553 CACAGACAAAAAACAGCCCATGG - Intronic
957613504 3:82498847-82498869 AACAAACAAAAAACAGCCCAGGG + Intergenic
959773014 3:110122754-110122776 CTCAAAAAAAAGACAGTAAATGG - Intergenic
959924282 3:111904275-111904297 CTCAAAAAAAAAAAAGGCCAAGG + Intronic
960649907 3:119935768-119935790 CTAAAACCAAAGACATGACAAGG + Intronic
961169828 3:124789267-124789289 GTCAAACAAAACACCTGCCATGG - Intronic
961625079 3:128255951-128255973 CCCAAACAGAAGCCAGGCGAAGG - Intronic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
967718044 3:192785994-192786016 CAGAAATAAAAGACAGGCAAAGG + Intergenic
968152169 3:196345558-196345580 CTCAAGCAGAAGACATGCCTCGG + Intergenic
968532727 4:1102849-1102871 CTCAAAAAAAAGGCCGGGCACGG + Intronic
969464311 4:7345844-7345866 CTCAGAGAAAAGAGAGGACAGGG - Intronic
971335961 4:25724418-25724440 CTCAAAGAAAAGAAAAGACAAGG + Intergenic
972901795 4:43694342-43694364 CTCTAAGCAAAGACAAGCCAAGG - Intergenic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
975502048 4:75097802-75097824 CTCAAACCAAAAACATGCAATGG - Intergenic
975933206 4:79552379-79552401 CTCAAAGAAAAGGGAGGTCAAGG - Intergenic
977021674 4:91768074-91768096 CTCAAAGGAAAAATAGGCCAAGG - Intergenic
978870079 4:113565358-113565380 GTCAAAAAAAAGGCTGGCCATGG + Intronic
979199198 4:117956664-117956686 CTCTAACAGAAGACATGCTAAGG + Intergenic
979433327 4:120659131-120659153 TTCAAACAAAAGACAGACTTCGG + Intergenic
979478979 4:121192433-121192455 CTCAAACAAAACTCATGCAAAGG - Intronic
980127675 4:128789071-128789093 TTCAAAGAAAAGACAGGGCTGGG + Intergenic
980620225 4:135291602-135291624 CAGAAAGAAAAGACAGGGCAAGG - Intergenic
981145150 4:141315370-141315392 CTGAAACAGAAGACAGCCCAAGG + Intergenic
982802452 4:159722105-159722127 CTCAAGCAAAACTCAGGCAAAGG - Intergenic
983211540 4:164963458-164963480 ATCACACAAATGACAGGGCACGG + Intronic
984155806 4:176195241-176195263 TTGAAACATAAGCCAGGCCAGGG + Intronic
984573259 4:181418712-181418734 CTCAAACATAAGAAAAGCCCAGG - Intergenic
986376942 5:7141955-7141977 CTCTGAGAAAAGAAAGGCCAGGG + Intergenic
987424408 5:17756410-17756432 CTCCAACAAAGGAGTGGCCATGG - Intergenic
988184671 5:27845295-27845317 CTCTAAGAAAAGGCAGGTCAGGG + Intergenic
992557527 5:77917692-77917714 CTAAACCAAAACACAGGCCCAGG - Intergenic
992844967 5:80737322-80737344 CTTAAAAAAAAGACAGACAAAGG - Intronic
993148905 5:84135001-84135023 CACAAACTAATGACAGGGCAGGG + Intronic
994042822 5:95276972-95276994 AACAAACAAAAAACAGGTCAAGG + Intronic
994691733 5:103027903-103027925 CTCTGACAAAAGAAAGGTCAAGG - Intronic
995898691 5:117044643-117044665 TTCATGCTAAAGACAGGCCAGGG - Intergenic
998812166 5:145977208-145977230 CTAAAACAAAAGACAAGACAAGG + Intronic
999889417 5:155960405-155960427 CTCAAACAGAAGACTGGCCTGGG - Intronic
1000169369 5:158686785-158686807 CTCAAAGAAAATACAGCCCAAGG - Intergenic
1000315832 5:160089716-160089738 CTAAAACAAAGGATTGGCCAGGG - Intronic
1001145376 5:169179301-169179323 CTCAAACAAAAACCAAGCCTTGG - Intronic
1002158313 5:177300220-177300242 ATAAAACAAAACACAGGGCAAGG - Intergenic
1002617118 5:180462855-180462877 CTCAAAAAAAATCCTGGCCAGGG - Intergenic
1002681220 5:180966625-180966647 CTCAAAGAAAAGAACAGCCAAGG + Intergenic
1003415469 6:5903719-5903741 GTCAAGCAAAAAACAGGCCTGGG - Intergenic
1003475350 6:6476912-6476934 CTAAAATCCAAGACAGGCCATGG + Intergenic
1004008182 6:11656109-11656131 CCCAAACAAAAGGCAGAACAGGG + Intergenic
1004359202 6:14956064-14956086 AACAAAAAAAAGAAAGGCCAAGG - Intergenic
1006507362 6:34498031-34498053 AACAAACAAAAAACAGGCAAAGG - Intronic
1007004966 6:38352531-38352553 CTGAATCAAAAGAAAGGCCTAGG + Intronic
1008680971 6:53871960-53871982 CAAAAGCAAAAAACAGGCCAGGG - Intronic
1009701325 6:67185723-67185745 CTGAAACAAAAGAGAACCCAGGG + Intergenic
1010259985 6:73804581-73804603 CTCAAGCCAAATACAGCCCAGGG - Intronic
1011901623 6:92304895-92304917 CTCAAACCAAAAACATACCATGG + Intergenic
1012160421 6:95878035-95878057 CTCTAACAAAAGGGAAGCCAGGG + Intergenic
1013854104 6:114551335-114551357 TTTAAGCAAAACACAGGCCAAGG - Intergenic
1014921847 6:127222789-127222811 CTCAGACAAAAGAGAGACCATGG + Intergenic
1017333222 6:153223979-153224001 CACACACAGAAGAGAGGCCATGG + Intergenic
1017349160 6:153419250-153419272 CTCAAAAAAAAGAAAGGTAAAGG + Intergenic
1019923469 7:4177586-4177608 CTGAACCAAAAGGCAGGCCCAGG + Intronic
1022139860 7:27484151-27484173 CTCAAAAAAAAGACAGCACATGG - Intergenic
1024266377 7:47609993-47610015 CTCAAAAAAAAAAAAGGCCCTGG + Intergenic
1024557605 7:50616890-50616912 ATCAAAGGGAAGACAGGCCAAGG + Intronic
1025297330 7:57786275-57786297 CTGAATCTTAAGACAGGCCAAGG - Intergenic
1026512752 7:71040626-71040648 GTCAAACAGAAGACAGCCCTGGG + Intergenic
1027575331 7:79923279-79923301 CTCAAGCAAAACTCAGGCAATGG + Intergenic
1028052950 7:86207813-86207835 CTCAAACAAAACTCAGGCAAAGG - Intergenic
1028054396 7:86225126-86225148 CCCAAGCAAAACACAGGCAAGGG - Intergenic
1028987724 7:97021300-97021322 CCCAAACAAAAGACAAGCCTTGG - Intronic
1030593548 7:111509333-111509355 CTCAAACAAGGGACAGACTATGG + Intronic
1031280444 7:119793675-119793697 CTCAAACCAAAAACATGCAATGG - Intergenic
1031971890 7:128070677-128070699 CTCAAACAGAAGACACGTTAGGG - Intronic
1032158941 7:129495375-129495397 CTCAAAAAAAAAAGAGGACACGG + Intergenic
1032271274 7:130409533-130409555 CCCTAACAAAAAACAGTCCAGGG + Intronic
1032475541 7:132209162-132209184 GTCAACCAAAGGCCAGGCCATGG + Intronic
1035096248 7:156358274-156358296 CTCAAACAAACGACACTCTAGGG + Intergenic
1035285326 7:157802341-157802363 GTGAAACAAAAGCCAGGCCCAGG - Intronic
1035744153 8:1949818-1949840 ATAAAACAAAGGACAGGCCAGGG - Intronic
1037005925 8:13779759-13779781 TCCAAACAAAAGACAAGCCTGGG - Intergenic
1037422595 8:18719427-18719449 CAGAAGCAAAAGACAGGTCAAGG + Intronic
1039381705 8:37091883-37091905 CTTAAACAAAAGACATGCCATGG - Intergenic
1040502743 8:48019524-48019546 CTCAAAAAAACGGCAGGGCATGG + Intronic
1041563446 8:59247501-59247523 CTGAAGCAAAAGAAAGGCCTTGG + Intergenic
1041872855 8:62654865-62654887 CTCAAATAAGAGAGAGGCCATGG + Intronic
1042676077 8:71323918-71323940 CTAAGACAGAAAACAGGCCAAGG + Intronic
1043342357 8:79255527-79255549 CTCAAAAATGACACAGGCCAAGG + Intergenic
1043690179 8:83141302-83141324 CTCTAAAAAAAGAAAGGTCAGGG + Intergenic
1044294516 8:90511741-90511763 CTCTAAGAAAAGAGAGGTCAGGG - Intergenic
1045324601 8:101109021-101109043 CTCAGAAAACAGACAGGACAGGG + Intergenic
1046543326 8:115615073-115615095 CTCAAACATAAGACAGTACTTGG + Intronic
1047850175 8:128848535-128848557 CACACACAGAAGAAAGGCCATGG + Intergenic
1048369388 8:133764352-133764374 CACAAAGAAAAGAAAGGCCAGGG - Intergenic
1048873936 8:138821870-138821892 CTCAAATAAAAGACAGTGTAGGG - Intronic
1050454180 9:5817186-5817208 CTCAAAAAAAAGGCTGGGCACGG - Intronic
1052197781 9:25738629-25738651 CTCTAACAAAAGGCAAGTCAAGG + Intergenic
1056683854 9:88743569-88743591 CTCAAACAAATTAGAGTCCAGGG - Intergenic
1057793510 9:98139793-98139815 CTCAAACAAAAAACAAAACACGG + Intronic
1058569559 9:106326098-106326120 CTCAAAGAAATGACAGCCCAGGG + Intergenic
1058713881 9:107705727-107705749 TTCTCACAAAAGAGAGGCCAGGG - Intergenic
1060201864 9:121656006-121656028 CTCAAAAAAAAAAAAAGCCAGGG - Intronic
1060809987 9:126606261-126606283 CCCAAACAGAAAACAGGGCAGGG - Intergenic
1061594707 9:131621413-131621435 CTCAATCAAAGCACAGGACATGG - Intronic
1188157502 X:26757496-26757518 CTCTAACTAAAGACAGCTCACGG + Intergenic
1188497473 X:30795184-30795206 GGCAAACAAAAGGCAAGCCAAGG - Intergenic
1191764950 X:64687988-64688010 CTCATTCTGAAGACAGGCCAAGG - Intergenic
1191765797 X:64697155-64697177 CTCAGAGCAAAGACAGCCCAAGG + Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192936627 X:75866175-75866197 CTCAAAAAAAAAAAAAGCCAAGG - Intergenic
1194928502 X:99858760-99858782 CTCAACCAAGAAGCAGGCCAGGG - Intergenic
1196012929 X:110907239-110907261 GTGAAACATAAGACAGGTCATGG + Intergenic
1196017084 X:110951110-110951132 CTCAAAAGAAAAACAGGCAAGGG - Intronic
1197212120 X:123836754-123836776 CTCACACATAAGACAAGGCAAGG - Intergenic
1197813052 X:130466048-130466070 CTCAAGCAAAAGACAAGCTCTGG - Intergenic
1197841453 X:130751886-130751908 CTCAATCAAAACATAGGCTAAGG - Intronic
1200055071 X:153455987-153456009 ATCAAACAGAGGCCAGGCCAAGG + Intronic
1200257488 X:154591984-154592006 CTCAATTAAAACACAGGACAAGG - Intergenic
1200914868 Y:8562756-8562778 CCCACATAAAAGACAGGCAAGGG - Intergenic
1201512741 Y:14783273-14783295 CTCAAACAATAGAAAAGCCATGG - Intronic