ID: 924386730

View in Genome Browser
Species Human (GRCh38)
Location 1:243506167-243506189
Sequence CTGCGGTCCTTGGGCCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924386730_924386737 8 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386737 1:243506198-243506220 ACAAAGTCCCAAGGGCCCCCTGG 0: 1
1: 0
2: 3
3: 24
4: 164
924386730_924386742 24 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386742 1:243506214-243506236 CCCCTGGCCTCACAGTCTCCTGG 0: 1
1: 0
2: 6
3: 40
4: 416
924386730_924386736 0 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386736 1:243506190-243506212 AACTTTGAACAAAGTCCCAAGGG No data
924386730_924386744 25 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386744 1:243506215-243506237 CCCTGGCCTCACAGTCTCCTGGG 0: 1
1: 0
2: 4
3: 77
4: 841
924386730_924386747 27 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386747 1:243506217-243506239 CTGGCCTCACAGTCTCCTGGGGG 0: 1
1: 0
2: 4
3: 44
4: 298
924386730_924386746 26 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386746 1:243506216-243506238 CCTGGCCTCACAGTCTCCTGGGG 0: 1
1: 0
2: 3
3: 51
4: 376
924386730_924386735 -1 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386735 1:243506189-243506211 GAACTTTGAACAAAGTCCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 189
924386730_924386748 30 Left 924386730 1:243506167-243506189 CCCGTCAGGCCCAAGGACCGCAG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 924386748 1:243506220-243506242 GCCTCACAGTCTCCTGGGGGAGG 0: 1
1: 0
2: 6
3: 36
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924386730 Original CRISPR CTGCGGTCCTTGGGCCTGAC GGG (reversed) Intronic
900136662 1:1120516-1120538 CTGAGCTCCTCGGCCCTGACTGG + Intergenic
900243710 1:1628413-1628435 CCCCGGTCCTTGGGCAGGACTGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900432195 1:2607683-2607705 CTGCAGGCCTTTGACCTGACGGG - Intronic
901319439 1:8330520-8330542 CTGCCGTACTTGGGCGTGAGGGG - Exonic
902785831 1:18732017-18732039 CTGAGGTCCCTGGGGCTGAGGGG - Intronic
903679374 1:25087137-25087159 CTGTGGTCCTTGGCCTTGTCTGG - Intergenic
906700844 1:47857052-47857074 CTTCGGTCCTTGAGCCTGTTGGG + Intronic
910034739 1:82776905-82776927 CTGCAGTCCTGAGGCCTGCCCGG + Intergenic
912879070 1:113390809-113390831 CTGCGCTCCCCGGGGCTGACCGG - Intronic
915102142 1:153508234-153508256 CTGGGGTCCTGTGGCCAGACAGG + Intergenic
922863364 1:228838101-228838123 CTGGAGTCTTTGGGCCTGGCAGG - Intergenic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
1066261982 10:33738124-33738146 CTGCGGTCCTCAGAACTGACAGG + Intergenic
1069627540 10:69877411-69877433 CTGGAGTCCTTGGACCTGGCCGG - Intronic
1069952969 10:72032322-72032344 CTGGAGTCCTGGGGCCTGAGAGG - Intergenic
1069959957 10:72073743-72073765 CTGCGGTCCACGGGCCTGAGAGG - Intronic
1070750905 10:78963517-78963539 CTCTGGGCCTTGGGGCTGACTGG - Intergenic
1073562612 10:104509767-104509789 GTGGGGTCCCTGGGCCTGGCTGG + Intergenic
1077669612 11:4145603-4145625 CTGTGGTCTTTGGGTCAGACTGG + Intergenic
1079110134 11:17600712-17600734 CTGTGGTCCCTGGGGCAGACAGG + Intronic
1083551215 11:63591493-63591515 CTGGGGGCCTTGACCCTGACAGG - Intronic
1084212274 11:67629739-67629761 CTGCGGTCCAGCCGCCTGACCGG - Exonic
1085508443 11:77073301-77073323 CTGCAGGCCTTGGGCAGGACAGG - Intronic
1089009291 11:115119569-115119591 CGACTGTCTTTGGGCCTGACTGG - Intergenic
1089695817 11:120215819-120215841 CTGCCTGCCTTGGGGCTGACCGG + Intronic
1091690863 12:2596587-2596609 CTGCGCTCCTGGGGCCTGCTTGG + Intronic
1096232082 12:49902462-49902484 CAGTGGTCCTTGGGCCTGGATGG - Intronic
1102256502 12:111418482-111418504 CTGCGGGCCTTGGGCAGGCCAGG - Exonic
1102465455 12:113128201-113128223 CTGGGGTCCTCGGGCCACACAGG + Intronic
1103506642 12:121445500-121445522 CTGCTCCCCTTGGGCCTGCCAGG + Intronic
1103723251 12:122985844-122985866 CTCACGTCCTCGGGCCTGACGGG - Exonic
1104746441 12:131213973-131213995 CTGAGGTCCCTGCGCCTGAGAGG + Intergenic
1108251601 13:48573269-48573291 CTGCGCACCTGGGACCTGACTGG - Intergenic
1113494546 13:110716068-110716090 GTGCTGTCCTCGGGCCGGACGGG + Intronic
1114740937 14:25096416-25096438 CTGAAGTCCATGGGCCTAACAGG - Intergenic
1118493833 14:66288270-66288292 CTGAGCTCCCTGGGCCTCACTGG - Intergenic
1119151505 14:72364235-72364257 CTTCTGTCCTGGGGCTTGACTGG - Intronic
1121013805 14:90536334-90536356 CTGGGAGCCATGGGCCTGACGGG - Exonic
1121337256 14:93085002-93085024 CTGCAGACCCTGGGCCTGGCAGG + Intronic
1122105047 14:99446682-99446704 CTGCGGTCCTTGGCCCTTTTAGG - Intronic
1122780402 14:104141035-104141057 CTGCCATCCTGGGGCCTTACGGG + Intronic
1124578002 15:30926372-30926394 CTTCCGCCCTTGGGCCTGGCAGG + Intronic
1125395297 15:39240830-39240852 CTGTTCTCCTTGGGTCTGACAGG - Intergenic
1130040857 15:80404414-80404436 CGGCGGCGCCTGGGCCTGACCGG + Exonic
1131046264 15:89318461-89318483 GAGCGTTCCTTGGGCCAGACTGG - Intronic
1132480856 16:165465-165487 CTGGGGTCCTTGAGTCGGACGGG + Intronic
1133018300 16:2955019-2955041 ATGCTGTCCTCGGGCCTCACGGG - Intergenic
1133201199 16:4205697-4205719 CTGAGGTCCTCAGGGCTGACCGG + Intronic
1139545663 16:67648453-67648475 CTGCGGCACCTGGGCCTGGCGGG + Exonic
1140201323 16:72897106-72897128 CTGCCTGCCTTTGGCCTGACAGG - Intronic
1141297458 16:82783213-82783235 TTGCGGTCTTTGGCCCTGAAGGG - Intronic
1145211444 17:21016231-21016253 CTGGTGTCCATGGGCCTGAGTGG - Intronic
1148847800 17:50539328-50539350 CTGCGGTGCTTGGGATGGACAGG + Intronic
1149498759 17:57135685-57135707 CTGAGGTCTTTGTGCCTGAACGG - Intergenic
1151499611 17:74480485-74480507 CTGGCGTCCCTGGGGCTGACAGG + Intronic
1152256939 17:79245354-79245376 CTGGGGTCCTTTGGTCTGAACGG - Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152735740 17:81996025-81996047 CTGCAGTCGCTGGGCCTGACCGG + Exonic
1159917924 18:74202678-74202700 CTGGGGTCCTGGGCTCTGACTGG - Intergenic
1160221561 18:76981697-76981719 CTGCCGGCCTGGGGACTGACAGG + Intronic
1160581028 18:79884679-79884701 CTGTGGGCCTTGGGCGTGTCCGG - Intronic
1160912464 19:1481286-1481308 CTGGGGTCCCTGGGCCTGGGCGG + Intergenic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1164078695 19:21844115-21844137 CTGCGGCCCTAGGCCCAGACTGG + Intronic
1166837643 19:45677241-45677263 CCGCGGGTCTTGGGCCTGGCGGG + Intronic
926036117 2:9637229-9637251 CTGCGTACCTAGGGCCTGCCTGG - Intergenic
927636284 2:24819655-24819677 CTGCCGTCCTTGCCCCTGAGGGG - Exonic
929576899 2:43057604-43057626 CCGCGGTCCTCGGTCCTGCCTGG + Intergenic
932387314 2:71347675-71347697 CTGCTGACCTTGGTCCTGAATGG + Intronic
933902826 2:86861768-86861790 CTGCGCTCCCGGGGCCTGAGCGG - Intronic
935777721 2:106487501-106487523 CTGCGCTCCCGGGGCCTGAGCGG + Intergenic
938901629 2:135803404-135803426 CTGCGGCCCATGGGGCTGATAGG - Intronic
942124019 2:172805115-172805137 ATGTGGTCCTGGGGCCTGCCTGG - Intronic
943646741 2:190414095-190414117 CTGTGTTCCTGGGGCCTGTCTGG + Intronic
948119538 2:235518898-235518920 CTCCTGTCCTTGGGCCTCAGTGG + Intronic
1169559329 20:6782714-6782736 CTGTGGTCCTTTGGCCTGTAAGG - Intergenic
1172166893 20:32905012-32905034 CTGCGGTTCTTAGGCCTGTGAGG + Intronic
1173813056 20:45968101-45968123 CTGCACTCCCTGGGCCTGCCTGG - Intronic
1175820717 20:61907395-61907417 CTGCAGTCCTTGGGTGTGAGAGG - Intronic
1175940998 20:62537491-62537513 CAGCGTTCCTGGGGCCTGGCAGG - Intergenic
1175973138 20:62697203-62697225 CTGTGGACCTTGGGCCAGGCTGG + Intergenic
1177194360 21:17886963-17886985 CTGAGGTCCTAGGGGATGACAGG + Intergenic
1180137652 21:45871618-45871640 CTGCAGTCCCTGAGCCTAACCGG + Intronic
1181016648 22:20073494-20073516 CTGACATCCTTGGGCCTGTCAGG + Intergenic
1181940202 22:26470010-26470032 CAGGGGCCCTTGGGCCAGACAGG - Intronic
1184478180 22:44732523-44732545 CCCCGGTCCCTGGCCCTGACAGG - Intronic
1184479913 22:44740325-44740347 TTGGGGTCCGTGGGCCTGCCGGG + Intronic
1185169023 22:49281458-49281480 CTGAGGTCCTGGGGCCAGAGTGG + Intergenic
954025617 3:47781420-47781442 CCGCGATCCCGGGGCCTGACTGG - Intronic
954398070 3:50303458-50303480 CTGCTGACCTTGGGGCTGAAGGG + Exonic
954622111 3:52002266-52002288 ATGGAGTCCTTGGGCATGACTGG + Intergenic
961957015 3:130814929-130814951 GTGCGGTGCTTGGGCATGGCAGG + Intergenic
962755002 3:138460032-138460054 CCGCAGTCCTTGGGACTCACCGG - Exonic
965697161 3:171421308-171421330 GTGAGGTCCCTGAGCCTGACTGG + Intronic
968189899 3:196660118-196660140 CTGCGGTCCGTGTCCCTGGCGGG + Exonic
970131923 4:12880917-12880939 TTGCGGTCCATGGGAGTGACTGG - Intergenic
972978891 4:44671519-44671541 CTACTGACCTTGGGCCTGCCGGG + Intronic
974973007 4:68854105-68854127 CTTCGGTCCATGGGACAGACAGG + Intergenic
985588970 5:755123-755145 CTGCGCACTTGGGGCCTGACAGG - Intronic
985603650 5:847639-847661 CTGCGCACTTGGGGCCTGACAGG - Intronic
986291625 5:6404335-6404357 CTGAGGTCCATGTGCCTGGCTGG - Intergenic
996522111 5:124438575-124438597 CTGCGGTGGAAGGGCCTGACCGG + Intergenic
1005573338 6:27168174-27168196 CTGAGTTTCTTGGGCCTGCCAGG - Intergenic
1014961352 6:127689290-127689312 CTGAGGTTCCTGGGCCTGCCAGG + Intergenic
1021659815 7:22908787-22908809 CTGGGGGCCTTGGGCCACACTGG + Intergenic
1022881195 7:34589115-34589137 CTGCGGTTCATCGCCCTGACAGG + Intergenic
1023585383 7:41724544-41724566 CTGATTTCCTGGGGCCTGACTGG - Intergenic
1031895715 7:127346405-127346427 CTGCCTTCCATGGGCCTTACTGG - Intergenic
1032344837 7:131107938-131107960 CCGGGGTCCTTGGCCCTGGCCGG - Intergenic
1036720553 8:11171444-11171466 CTCCAGTACTGGGGCCTGACAGG + Intronic
1037994895 8:23344926-23344948 CTGCCCTCCTTGGGCCTTGCTGG + Intronic
1041123743 8:54613333-54613355 CTGGGTTCCTTGGGCCTGCCTGG + Intergenic
1044489186 8:92792054-92792076 CTGGGATCCTAGGGCCTCACGGG + Intergenic
1047202610 8:122780143-122780165 CGGCTGGCCTTGGGGCTGACTGG - Intergenic
1049092981 8:140530675-140530697 CTGCTATCCTTGGGCCTCCCAGG + Intergenic
1049228098 8:141467296-141467318 CTCAGGTCCTTGAGCCTGATGGG - Intergenic
1049261658 8:141642214-141642236 CTGCGGTCCCTGGGCCTCGCAGG - Intergenic
1049268188 8:141680743-141680765 CTGAGGCCCATGGGCCTGACTGG + Intergenic
1049289542 8:141794504-141794526 CTGGGGTCTGTGGGCCTCACAGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1056307286 9:85302548-85302570 ATGCTGTCCATGGGGCTGACTGG - Intergenic
1058404153 9:104652920-104652942 CTGAGGTGCTTGGGTCTGATAGG - Intergenic
1059250812 9:112886574-112886596 CAGCTGTCCTTGGCTCTGACCGG - Exonic
1060828242 9:126698553-126698575 CTGGGCTGCTGGGGCCTGACTGG + Exonic
1061621490 9:131813995-131814017 CTGGGGTCCCTCGGCCTCACGGG - Intergenic
1062132751 9:134908758-134908780 CTGGAGTCCCTGGGCCTTACTGG - Intronic
1203787605 EBV:136621-136643 CTACGGTCCTGGGGCCGGAGCGG + Intergenic
1187388667 X:18871633-18871655 CTGGGGTCCCTGGGCCTGTGGGG + Intergenic
1190280410 X:48925453-48925475 GTGGGGTCCTTGACCCTGACTGG - Intronic
1192282605 X:69701452-69701474 CTGCGGCCCTTGGGCCTGCAGGG + Intronic
1199601154 X:149541804-149541826 CTGTGGTCCTTGACCCAGACAGG + Exonic
1200035067 X:153321438-153321460 CTGCGGGCCCTGGGCCGGACCGG + Intergenic