ID: 924388437

View in Genome Browser
Species Human (GRCh38)
Location 1:243523654-243523676
Sequence AGGATTGGATTAAAATTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924388437_924388444 25 Left 924388437 1:243523654-243523676 CCAATTAATTTTAATCCAATCCT 0: 1
1: 0
2: 2
3: 12
4: 279
Right 924388444 1:243523702-243523724 TTACTCTTAAAATCTGGGTCAGG 0: 1
1: 0
2: 3
3: 20
4: 167
924388437_924388440 -2 Left 924388437 1:243523654-243523676 CCAATTAATTTTAATCCAATCCT 0: 1
1: 0
2: 2
3: 12
4: 279
Right 924388440 1:243523675-243523697 CTAACTGCAGCTTCTATAACAGG 0: 1
1: 0
2: 0
3: 8
4: 168
924388437_924388441 19 Left 924388437 1:243523654-243523676 CCAATTAATTTTAATCCAATCCT 0: 1
1: 0
2: 2
3: 12
4: 279
Right 924388441 1:243523696-243523718 GGTCCTTTACTCTTAAAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 134
924388437_924388442 20 Left 924388437 1:243523654-243523676 CCAATTAATTTTAATCCAATCCT 0: 1
1: 0
2: 2
3: 12
4: 279
Right 924388442 1:243523697-243523719 GTCCTTTACTCTTAAAATCTGGG 0: 1
1: 0
2: 2
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924388437 Original CRISPR AGGATTGGATTAAAATTAAT TGG (reversed) Intronic
901989143 1:13098220-13098242 AGCCATGGATGAAAATTAATGGG - Intergenic
901992670 1:13128547-13128569 AGCCATGGATGAAAATTAATGGG + Intergenic
903432079 1:23312649-23312671 CTGATTGGTTTATAATTAATTGG - Intronic
903612887 1:24629603-24629625 AGGATTGGTTCAAGATTACTAGG - Intergenic
903818216 1:26081043-26081065 AGGATCAGATTATATTTAATAGG - Intergenic
905758591 1:40534140-40534162 AGGATTGCATTAAACTTAATAGG + Intronic
908048041 1:60193761-60193783 AAGATTAGTTTAAAATTTATAGG - Intergenic
908373867 1:63513301-63513323 AGGAATGGCTTAAAATCCATTGG - Intronic
908447043 1:64209193-64209215 ATTATTGGATTAAATTCAATGGG + Intronic
910677028 1:89825072-89825094 AAGACTGGATCAAAATAAATAGG - Intronic
910739377 1:90498232-90498254 AGGTTTGGAATAAAGTTTATTGG - Intergenic
912075906 1:105874989-105875011 AGAATTGGCTTAAGATAAATGGG - Intergenic
918178358 1:182065035-182065057 AGGATGTGATGAAGATTAATTGG - Intergenic
919025462 1:192163716-192163738 AGCATTGTAATAAAAATAATTGG - Intronic
919158496 1:193799322-193799344 GGGATTGGATTAAATTTACCAGG + Intergenic
920545146 1:206810208-206810230 TGGATTGGATTGAATTTATTGGG + Intronic
920786234 1:209044275-209044297 ATGAAAGGATTAAAATAAATGGG + Intergenic
923487958 1:234454437-234454459 AGGATTTGATTCAAAATAATTGG + Intronic
924065660 1:240219237-240219259 AGGACTGAATTTAGATTAATTGG + Intronic
924388437 1:243523654-243523676 AGGATTGGATTAAAATTAATTGG - Intronic
924699752 1:246439261-246439283 AGGCTTGGATTCAAAATATTTGG - Intronic
1062960088 10:1566901-1566923 ATAATTGACTTAAAATTAATAGG + Intronic
1063814087 10:9752399-9752421 AGGACACTATTAAAATTAATAGG + Intergenic
1064302922 10:14138800-14138822 AGCAGTGGGTTAAAATTACTTGG - Intronic
1064407209 10:15074750-15074772 AAGATTGGTATAAAAGTAATTGG + Intergenic
1066765197 10:38796299-38796321 AGGATTGGATTCGAATTGAATGG - Intergenic
1072269903 10:93766202-93766224 AGGATTGGAAAAAAATTGTTAGG + Intronic
1072413335 10:95226208-95226230 ATGATTGGGTGAAAGTTAATTGG - Intronic
1073787208 10:106902776-106902798 GGGATTAAATTAAAATTACTGGG + Intronic
1075120688 10:119662431-119662453 AGGCCTGGATCAAAATTAAGTGG - Intronic
1075896887 10:126003978-126004000 ATGATTGGGTAAAAGTTAATGGG - Intronic
1078571689 11:12463876-12463898 AGTATTGGATTATAATAAAGTGG - Intronic
1078949508 11:16113892-16113914 AGGATTGGATTAAGACTGAATGG + Intronic
1079869167 11:25774777-25774799 AGGCTTTTATTAAATTTAATAGG + Intergenic
1080481862 11:32659994-32660016 AGGAATAGAGTAATATTAATTGG + Intronic
1085881175 11:80468008-80468030 ATCATTGAAATAAAATTAATGGG + Intergenic
1086459823 11:86995470-86995492 TGCAGTGGATTAAAATTTATGGG + Intergenic
1086826271 11:91502750-91502772 ATAATTTTATTAAAATTAATTGG + Intergenic
1088560105 11:111106111-111106133 AGGATTGGAAGAACATTAAGAGG + Intergenic
1089081240 11:115777809-115777831 AGGATGGGTTTAAAAAAAATAGG - Intergenic
1090117618 11:123990713-123990735 AGGATTAGGCTAAAAATAATTGG - Intergenic
1090993620 11:131843463-131843485 TAAATTGGATTAAAATGAATGGG - Intronic
1090997078 11:131876492-131876514 GGGCTAAGATTAAAATTAATTGG - Intronic
1094255623 12:28422259-28422281 AGTATTGAATTAAATATAATTGG - Intronic
1098444112 12:70548637-70548659 AGGTTCAGCTTAAAATTAATGGG + Intronic
1099448572 12:82781191-82781213 ATGAGTAGATCAAAATTAATAGG + Intronic
1100139429 12:91598765-91598787 AGGATTGGCGAAGAATTAATAGG - Intergenic
1100247396 12:92774128-92774150 AGGATAGAATTAAAACTATTTGG + Exonic
1100643012 12:96500762-96500784 AGGATTGCTTGCAAATTAATTGG + Intronic
1102838030 12:116085559-116085581 AAGGTTGGATTAAACTGAATAGG - Intronic
1107309844 13:39064891-39064913 ATGAATGGATAAAAAATAATTGG - Intergenic
1107323237 13:39211605-39211627 TTGATTTGATTAAAATTCATGGG - Intergenic
1107643146 13:42465162-42465184 AGGCTTGGATAAAAAAAAATTGG + Intergenic
1107952760 13:45479263-45479285 AGAATTACATTATAATTAATAGG + Intronic
1108942312 13:55972010-55972032 AGGTTTGGAGTATGATTAATTGG - Intergenic
1108960074 13:56215716-56215738 AGGATTATATTATGATTAATTGG + Intergenic
1109071037 13:57769229-57769251 AGTATAGGATGAAAATTAAATGG - Intergenic
1109088484 13:58007937-58007959 AGGCCAGGATCAAAATTAATAGG + Intergenic
1110695302 13:78481049-78481071 AGGATTGGATTAAATGAATTTGG - Intergenic
1110790878 13:79585440-79585462 ATGATTGAATATAAATTAATGGG + Intergenic
1111226322 13:85276641-85276663 CCTATTGGATAAAAATTAATAGG + Intergenic
1111794152 13:92896226-92896248 AGGAATGGATTTGGATTAATGGG - Intergenic
1112269374 13:97954338-97954360 TGGGTTGGATTTCAATTAATTGG - Intronic
1113377288 13:109776490-109776512 TAGATTGGATTAAAACTTATGGG - Intronic
1113523966 13:110959383-110959405 GGGGTTGGATTAAAAGTGATGGG + Intergenic
1114265899 14:21072364-21072386 GGGATTGGATTACAAAGAATCGG - Intronic
1115797855 14:36959295-36959317 AAGATCAGATAAAAATTAATGGG - Intronic
1116269829 14:42748936-42748958 AGAGATGTATTAAAATTAATTGG + Intergenic
1116758520 14:48980162-48980184 AGGATGAGATAAAAATTAGTAGG - Intergenic
1117109281 14:52432367-52432389 AGCATTGGAATAGAAGTAATTGG - Exonic
1118674787 14:68172094-68172116 AGGAATGTATTAAAATTGACTGG - Intronic
1120329969 14:83079679-83079701 AGGTTTGAATTAAAATCAATAGG - Intergenic
1120611022 14:86641599-86641621 AGGATGGGATTATAAATAATGGG - Intergenic
1123005742 14:105322638-105322660 AGGGTTGGATTAGAATAAAGTGG - Intronic
1123473957 15:20575260-20575282 AGTATTGGATTAAATCTGATAGG + Intergenic
1123644051 15:22425093-22425115 AGTATTGGATTAAATCTGATAGG - Intergenic
1123734257 15:23170272-23170294 AGTATTGGATTAAATCTGATAGG + Intergenic
1124284762 15:28391582-28391604 AGTATTGGATTAAATCTGATAGG + Intronic
1124297935 15:28520032-28520054 AGTATTGGATTAAATCTGATAGG - Intronic
1125108405 15:36001681-36001703 AGGAATCCATTGAAATTAATAGG + Intergenic
1126861973 15:52893719-52893741 AGCATTGGATAAAATTGAATAGG + Intergenic
1127346574 15:58107147-58107169 AGGTTTGGATAAAAATGAGTGGG - Intronic
1130198673 15:81805144-81805166 AGGAAAGGAATAAAAGTAATTGG + Intergenic
1130311640 15:82761173-82761195 AGCATTGGATGAACATTAATAGG + Intronic
1131188938 15:90298467-90298489 AGTATTTGATTAATACTAATAGG + Intronic
1131665072 15:94561766-94561788 AGGATTGGCTTTGTATTAATAGG + Intergenic
1132167496 15:99609913-99609935 AAACTGGGATTAAAATTAATTGG + Intronic
1133497930 16:6337495-6337517 AGGAGTGGAAATAAATTAATGGG + Intronic
1134153660 16:11824750-11824772 AGGCTTGGCTTCTAATTAATTGG + Intergenic
1134757019 16:16676179-16676201 ATTATTGGATTAAAACTATTTGG + Intergenic
1134989049 16:18682984-18683006 ATTATTGGATTAAAACTATTTGG - Intergenic
1135250015 16:20893024-20893046 AGGATTCAATTAAACTTTATCGG + Intronic
1136864283 16:33731110-33731132 AGGATTGGAAGAAAATTTATGGG - Intergenic
1137832341 16:51555896-51555918 TGGACTGGATTAAAAACAATGGG - Intergenic
1137938719 16:52659967-52659989 AGTATTAGCTTAAAACTAATGGG + Intergenic
1203125770 16_KI270728v1_random:1579248-1579270 AGGATTGGAAGAAAATTTATGGG - Intergenic
1143375788 17:6466310-6466332 TGGATTGAATTAAAATGCATGGG - Intronic
1145330758 17:21870097-21870119 AGGAATGGATTCAAATGAAAAGG + Intergenic
1146409673 17:32571545-32571567 AGAATTGGGTTTAAATTAAAAGG + Intronic
1149109605 17:53012284-53012306 AGGATTAAAATAAAATTAACAGG - Intergenic
1152061396 17:78078529-78078551 AGGATGTGATAAAAATTAAAGGG - Intronic
1153035848 18:761724-761746 GGAATTGGACTGAAATTAATGGG - Intronic
1155631092 18:27893756-27893778 ATGAATGGATTAAAAATTATAGG + Intergenic
1155860588 18:30893020-30893042 AGGATATGATTAAAATCCATAGG - Intergenic
1156202966 18:34855233-34855255 AGGATAGAATTAAAATTCTTTGG - Intronic
1156413577 18:36861970-36861992 TGGATTAGAATAAAATAAATGGG - Intronic
1158735396 18:60074098-60074120 AGGATTTTAATAAAATAAATTGG + Intergenic
1159819663 18:73124055-73124077 AAGATTGGAGTAAAAGGAATTGG - Intergenic
1164499037 19:28797010-28797032 ATAATTGGTTTAAAAATAATTGG + Intergenic
1165190217 19:34056899-34056921 TGGATTGGATTAGATTGAATTGG + Intergenic
1168261055 19:55194881-55194903 ATGAATGGATAAAAATGAATGGG + Intronic
1168590343 19:57629012-57629034 AGGTTTGCAGTAAAATTAAGGGG + Intergenic
925758505 2:7159290-7159312 AGTATTGGATTACAATCCATAGG - Intergenic
927793025 2:26025637-26025659 AGGATGGAATTAAAACAAATGGG + Intergenic
928657031 2:33463124-33463146 AGTTTTGGAATAAAAATAATTGG + Intronic
928702893 2:33917318-33917340 AGGTTTGGTTTAAATTTAAAAGG - Intergenic
930419417 2:51132297-51132319 AGGAATGAATAAAAATTTATAGG - Intergenic
930812509 2:55557783-55557805 AGGAGTGGCTTAAAATAAAAAGG - Intronic
931088286 2:58858861-58858883 AGGAATAATTTAAAATTAATTGG - Intergenic
932995109 2:76842247-76842269 AGGCTTGGATTAGAATCCATTGG + Intronic
934632502 2:95944031-95944053 AGTATTGGAAGAAAATTTATGGG - Intronic
934801000 2:97159229-97159251 AGGATTGGAAGAAAATTTATGGG + Intronic
935410871 2:102760536-102760558 AGGATTAGATTTAAGTTAAGGGG - Intronic
935833959 2:107029702-107029724 AGCATTGTAATAAAATCAATAGG - Intergenic
936985689 2:118309901-118309923 AGGATAAGATTAAATTTAGTGGG - Intergenic
937777847 2:125801766-125801788 AGTCTTGTATTAAAAATAATAGG + Intergenic
939717899 2:145608474-145608496 AGTATTGGCTTTAAATAAATGGG + Intergenic
939868312 2:147499554-147499576 AGGCATGGATTAAATTTTATAGG + Intergenic
940063565 2:149600031-149600053 GGCATTTGATTAAAATTATTAGG - Intergenic
940534267 2:154918995-154919017 AGGAAAGGATTAAGATTAAGGGG - Intergenic
941039030 2:160599596-160599618 AGGTTTGTATTAAGTTTAATTGG + Intergenic
941536221 2:166724987-166725009 AGGACTGAATCCAAATTAATTGG + Intergenic
941725377 2:168854462-168854484 AGGATTGAATAAAAAAGAATAGG - Intronic
943197505 2:184773455-184773477 AGTAGCCGATTAAAATTAATAGG + Intronic
943313405 2:186354965-186354987 ATGAATGTATTTAAATTAATGGG - Intergenic
943393613 2:187303753-187303775 TGTATTGCATTAACATTAATAGG - Intergenic
943398130 2:187368147-187368169 AGGATTGGCTTAAAAGTTAGAGG + Intronic
944363688 2:198891436-198891458 AGGATTAGCTTAAGATAAATAGG - Intergenic
945535357 2:211010790-211010812 TGGATTGGATTTTAATTCATAGG + Intergenic
1169552761 20:6718088-6718110 AGGATTGACTTGAAATTATTTGG - Intergenic
1169626075 20:7571021-7571043 AGGAGGGGATTAACAATAATTGG - Intergenic
1171921006 20:31098726-31098748 AGGAATGGATTCAAATTGAATGG + Intergenic
1171924535 20:31178218-31178240 AGGAATGGATTGAAATGAAATGG + Intergenic
1171929512 20:31216896-31216918 AGGAATGGATTCAAATTGAATGG + Intergenic
1173008028 20:39156080-39156102 AAGACAGGACTAAAATTAATGGG + Intergenic
1173638552 20:44582501-44582523 AGCATTGGATTACAACAAATGGG + Intronic
1174190272 20:48735455-48735477 AGGATGGGTTTAGAATTAACAGG + Intronic
1176530865 21:7956911-7956933 AGGAGTGGATTGAAATGAAGTGG - Intergenic
1176754219 21:10713775-10713797 AGGAGTGGAGTAAAATTGAGTGG - Intergenic
1177672705 21:24254107-24254129 AGGAATGGTTTCTAATTAATTGG + Intergenic
1177865330 21:26506229-26506251 AGAATTAAAGTAAAATTAATGGG - Intronic
1178251386 21:31006768-31006790 AAGATTGGATTAAAATCTGTAGG + Intergenic
1203304630 22_KI270736v1_random:100636-100658 AGGATTGGAGTAGAATGAAATGG + Intergenic
949297394 3:2541635-2541657 ATATTTGGTTTAAAATTAATTGG + Intronic
949998831 3:9640911-9640933 AGGAGTGGATCAAAAACAATAGG - Intergenic
951031560 3:17887714-17887736 AGAAAAGGGTTAAAATTAATTGG + Intronic
952005327 3:28836581-28836603 AGGATTGGATAAAAATTCTCTGG - Intergenic
952532697 3:34278676-34278698 AGGGTTGAATTAAAAAAAATTGG + Intergenic
952566038 3:34659465-34659487 AGGATTTGATGCAAATTAGTAGG - Intergenic
954952190 3:54485305-54485327 AGTTTTGGATTCAAATTCATAGG + Intronic
955457731 3:59142613-59142635 AGGCTTTGATACAAATTAATTGG - Intergenic
956558558 3:70548510-70548532 AGGATTTGACTAAAAATCATGGG - Intergenic
957162804 3:76631920-76631942 AGGTTTGGATTAAAATAATAAGG + Intronic
957347533 3:78981686-78981708 ACTTTTGGATTAAAATAAATTGG + Intronic
957766039 3:84625200-84625222 AGCATTAGAATAAAATTGATAGG + Intergenic
959689287 3:109180989-109181011 AGGAGAGGATGAGAATTAATGGG - Intergenic
960308156 3:116087853-116087875 ACAATTCGTTTAAAATTAATAGG - Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
965023987 3:163274340-163274362 AGGATTGAATTAGAAGTAAAGGG + Intergenic
965483399 3:169248168-169248190 AGAATTGCATTACAATTACTTGG + Intronic
967652209 3:192000325-192000347 AACATTATATTAAAATTAATTGG + Intergenic
970190964 4:13517329-13517351 AATATTGGATTAAAATTGACAGG - Intergenic
970757280 4:19442187-19442209 AAAATTAAATTAAAATTAATAGG + Intergenic
970909905 4:21262781-21262803 ATGCTTGGAATAAAATAAATGGG - Intronic
971629975 4:28978509-28978531 AGGATAGGATTAAAAACACTGGG + Intergenic
972619659 4:40734582-40734604 AGGACTGGCCTAAAATTTATAGG + Intergenic
975570117 4:75807697-75807719 AGAACTGTATTAAAATTAAAGGG + Intronic
975853773 4:78601002-78601024 ATGACTGGATTAGAATTTATAGG - Intronic
975896499 4:79098873-79098895 AGGATAGAGTTTAAATTAATTGG + Intergenic
975966193 4:79975428-79975450 TGAATTGAATCAAAATTAATAGG + Intronic
977091667 4:92684519-92684541 AGGATTATTTTAAATTTAATGGG + Intronic
978274081 4:106927749-106927771 TGTATTTCATTAAAATTAATGGG - Intronic
979817229 4:125124644-125124666 TGGAGTGAAATAAAATTAATGGG - Intergenic
980270374 4:130576551-130576573 ATGATTGGATTAAAATGCAAAGG - Intergenic
980530865 4:134051920-134051942 AGGATTAGATATAAATTAAATGG + Intergenic
981112195 4:140948420-140948442 AGCATTGGATTACAATACATGGG - Intronic
981224465 4:142276994-142277016 AAAATTGCATTAAAATTAACAGG + Intronic
981597027 4:146436539-146436561 AGAAGTGAATTAAAATTATTTGG - Intronic
981843182 4:149135960-149135982 AGGATTTGCTGAAAATAAATCGG - Intergenic
984195521 4:176654402-176654424 AAGATTGTAATAGAATTAATAGG + Intergenic
984485025 4:180357271-180357293 AGGTTTGGAATAAAATAAAATGG + Intergenic
984517480 4:180758223-180758245 AGAATTGAATTGAAATGAATTGG + Intergenic
984787435 4:183581756-183581778 GGAAATGGATGAAAATTAATTGG - Intergenic
985112101 4:186556287-186556309 AGGATTTGAATAAGATGAATAGG + Intergenic
985133241 4:186759897-186759919 AGCATTGCATTGATATTAATTGG + Intergenic
986914793 5:12606229-12606251 AAAATGGGATAAAAATTAATAGG + Intergenic
986986687 5:13508194-13508216 AGGAATGAATTAAAATGAAAGGG + Intergenic
987481866 5:18469014-18469036 AGTTTTGGCTTAAAATTGATTGG - Intergenic
988346688 5:30045917-30045939 ACGCTTAGATTAAAATTAATTGG - Intergenic
988908419 5:35814297-35814319 AGGGTGGGATTAAAACTAAATGG + Intronic
989076450 5:37568377-37568399 AGGATTCAATTAAAATAAACAGG - Intronic
989332148 5:40272602-40272624 AGGATTGGAGTAAAAGAAAATGG + Intergenic
989487151 5:42004560-42004582 AGGACTGGAAAAAAATTATTTGG + Intergenic
990773853 5:59283268-59283290 AGTATTTGATTTAAAATAATTGG + Intronic
993437380 5:87914752-87914774 AGGATTAGAAAAAAATTAAAAGG - Intergenic
993850215 5:92999275-92999297 TGGGCTGGACTAAAATTAATTGG - Intergenic
994318818 5:98365630-98365652 AGGATTGCTATACAATTAATTGG + Intergenic
994920534 5:106037055-106037077 AACATAGGATTAAAATTAAGGGG + Intergenic
994967872 5:106697713-106697735 AAGATTAGATTAAAATCATTAGG + Intergenic
995415563 5:111908650-111908672 AGGATCGGATTAAAAAAAAGTGG - Intronic
996193368 5:120572607-120572629 TAGATTGTATTTAAATTAATGGG + Intronic
996596928 5:125214892-125214914 AGGAAATTATTAAAATTAATTGG - Intergenic
998775336 5:145594044-145594066 AGTATTTGTTTCAAATTAATTGG + Intronic
998874948 5:146589811-146589833 ATGATTGGAATAGAATTAAAAGG - Exonic
998906424 5:146909982-146910004 TTCATTGGCTTAAAATTAATAGG + Intronic
999539561 5:152556743-152556765 TGGAATGGTTTAAAATTACTGGG + Intergenic
999807437 5:155095735-155095757 AGAATTTGATTAAAAAAAATTGG + Intergenic
999886477 5:155929097-155929119 AGAATTGGATTAGAATTAGAAGG - Intronic
1004996543 6:21199036-21199058 TGGATTGTATTAAAATCAAATGG + Intronic
1007690236 6:43696302-43696324 AGGTTTGCTTTATAATTAATCGG - Intergenic
1008051197 6:46901957-46901979 AGGAATGTATTAAAGTCAATAGG + Intronic
1009349999 6:62662360-62662382 AGGATCAGATTAAAATAATTAGG - Intergenic
1010681561 6:78805478-78805500 AGGATCAAATTAAAATTAAAGGG - Intergenic
1010699617 6:79027315-79027337 AGCTTTGGAGTAAAATAAATGGG + Intronic
1012375637 6:98558695-98558717 AGGATATGATGAAAATGAATTGG + Intergenic
1012512936 6:100025380-100025402 TGGTTTGGTTTCAAATTAATTGG - Intergenic
1012524187 6:100157548-100157570 AGGAATGGAGACAAATTAATAGG - Intergenic
1012560639 6:100576704-100576726 AAGATGGGATTAAAATAAATGGG + Intronic
1013223186 6:108098433-108098455 ATGATTGGATTAAAAATATGTGG + Intronic
1013481291 6:110555050-110555072 AGTATTGTATTAAAGTAAATGGG - Intergenic
1013702665 6:112792770-112792792 AGGAATGGAATAAAAAGAATGGG - Intergenic
1014738618 6:125123561-125123583 AGGATTGTTTTAAATTAAATAGG + Intronic
1016644513 6:146390494-146390516 AGCATTGGATTACATATAATTGG - Intronic
1016920971 6:149292927-149292949 AGGACTGAATTAAAATTCTTTGG + Intronic
1017981676 6:159406286-159406308 CAAATTGGGTTAAAATTAATGGG + Intergenic
1020452037 7:8331082-8331104 AGGAATGAATTAAAGTTCATCGG + Intergenic
1021888100 7:25160099-25160121 AGGGTGGCAGTAAAATTAATGGG - Intronic
1022344657 7:29502689-29502711 TGGTTTGGATTATAATTAAATGG - Intronic
1024769648 7:52705699-52705721 AGTATTGGATTATAATTCAAGGG + Intergenic
1024875191 7:54013989-54014011 AGAATGGGATTAAAATGTATAGG + Intergenic
1025226470 7:57169056-57169078 AGGATTAGATTGAACTGAATTGG + Intergenic
1027340330 7:77201021-77201043 AGGATTTGGCTAAAATTAAGGGG - Intronic
1027550670 7:79590341-79590363 ACAATTGAATTAAAATTATTTGG + Intergenic
1027909283 7:84228266-84228288 AAGATTGAATCAAAATTAGTGGG + Intronic
1027947773 7:84771217-84771239 AGGATTGTATATAAACTAATAGG + Intergenic
1027997427 7:85442417-85442439 AAAACTGGATTAAAATTATTGGG + Intergenic
1028085838 7:86636237-86636259 AGGATTGGATTAAAGTTCCGGGG - Intergenic
1028658143 7:93234619-93234641 ATTATTGGGTTAAATTTAATAGG + Intronic
1028661894 7:93287373-93287395 AGGATTTGCTGAAATTTAATGGG - Intronic
1030578275 7:111318039-111318061 AGGATTGCATTATAAGTAAGTGG - Intronic
1030945749 7:115717643-115717665 ATGATTGAATTAAAAATAAAAGG - Intergenic
1031418819 7:121524959-121524981 AGAATGGGAATAAAATTATTTGG + Intergenic
1031659601 7:124405306-124405328 AAGATTGGTTTAAAATTTCTTGG - Intergenic
1032852565 7:135807846-135807868 AAGATTGGAGTAAAATAGATTGG + Intergenic
1033374987 7:140751072-140751094 AGGATTGGTTTAACAATAAAGGG + Intronic
1039400225 8:37262937-37262959 AGGAATGGATTAAAAGTAAAGGG + Intergenic
1040651672 8:49456023-49456045 AGGATTGGATAGAATTTAAAAGG + Intergenic
1043973112 8:86554910-86554932 ATGATTGGAGAAAAATTAGTTGG - Exonic
1044185428 8:89245220-89245242 AGGAGTGAATTAAAAATAAAAGG - Intergenic
1044616766 8:94150425-94150447 AGGATTGGATTCAAATCCATTGG + Intronic
1044887708 8:96797493-96797515 AGGATTAGAATGAATTTAATAGG + Intronic
1044943184 8:97364333-97364355 AGGAGTGTATTAAAATTGTTAGG - Intergenic
1045149909 8:99393616-99393638 AAGCTTGCATAAAAATTAATAGG + Intronic
1046291082 8:112162625-112162647 ATGAATGAATTAAAATTCATTGG + Intergenic
1046330636 8:112710594-112710616 AGGTTTGGAGTAAAAAGAATTGG + Intronic
1047274043 8:123391835-123391857 GGGATTGGATTAAAATAAATCGG - Intronic
1048159750 8:132004591-132004613 AGGATTCAATTAAAATTGCTGGG + Intronic
1051638321 9:19201488-19201510 AGGCTTGGGTGAAAATCAATGGG + Intergenic
1052485548 9:29094698-29094720 AGAATTAGAATAAAATTATTGGG - Intergenic
1052734248 9:32323841-32323863 AGCATAGAAATAAAATTAATAGG - Intergenic
1052756712 9:32549918-32549940 GGAATTGGATTAAATTTGATAGG - Intronic
1053016225 9:34663815-34663837 AGGACTGGATAAAGATGAATAGG - Intronic
1055042277 9:71887419-71887441 AGCACTGCATTAAAATAAATAGG - Intronic
1203724185 Un_GL000216v2:36399-36421 AGGAATGGACTAGAATTAAGTGG - Intergenic
1203728496 Un_GL000216v2:70225-70247 AGGAATGGACTAGAATTAAATGG - Intergenic
1203385562 Un_KI270438v1:47340-47362 AGGAGTGGATTGAAATGAAGTGG + Intergenic
1203348601 Un_KI270442v1:57620-57642 AGGAGTGGAGTAAAATTGAGTGG + Intergenic
1187813022 X:23200935-23200957 AGGATGGGGTAAAAATTAAAAGG + Intergenic
1189507822 X:41630501-41630523 AGTATTGGATATAAAATAATTGG + Intronic
1189781165 X:44515701-44515723 AGGATTAGAAAAAAATTAAGAGG + Intergenic
1193956314 X:87868403-87868425 AGGAGGGGATTAAAATGCATAGG - Intergenic
1196201317 X:112888902-112888924 AGGATTGTTCTAAAATTATTTGG + Intergenic
1197374834 X:125669895-125669917 ATAATTTGATTAAAAGTAATAGG + Intergenic
1197409012 X:126093664-126093686 AGTATTGGATTTAATATAATAGG - Intergenic
1199504311 X:148544232-148544254 AGGACTGGATTATATTTAAGCGG - Intronic
1200590002 Y:5060129-5060151 AGAATTTAATTAATATTAATTGG + Intronic
1201100311 Y:10666713-10666735 AGGAGTGGATTGTAATTAAATGG - Intergenic
1201114824 Y:10827524-10827546 AGGAGTGGAATAAAATGAAATGG - Intergenic
1201138735 Y:11010493-11010515 TGGAGTGGAGTAAAATTGATTGG - Intergenic
1201139375 Y:11015646-11015668 TGGATTGGAGTAGAATCAATTGG - Intergenic
1201209571 Y:11667188-11667210 AGGAATGGATTAAAATTTAATGG + Intergenic
1201210180 Y:11672980-11673002 ACGAATGGAATAAAATTCATTGG + Intergenic
1201216140 Y:11724202-11724224 AGGAATGGACTAAAATTGAGTGG + Intergenic
1201216264 Y:11725303-11725325 AGGAATGGAATAAAATTGAATGG + Intergenic