ID: 924389910

View in Genome Browser
Species Human (GRCh38)
Location 1:243543153-243543175
Sequence ACAGCCAGGAGCTACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 668}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924389910_924389914 0 Left 924389910 1:243543153-243543175 CCCACATGGTAGCTCCTGGCTGT 0: 1
1: 0
2: 1
3: 60
4: 668
Right 924389914 1:243543176-243543198 CTTACTATCACCTTTACACTGGG 0: 1
1: 0
2: 1
3: 13
4: 102
924389910_924389917 29 Left 924389910 1:243543153-243543175 CCCACATGGTAGCTCCTGGCTGT 0: 1
1: 0
2: 1
3: 60
4: 668
Right 924389917 1:243543205-243543227 TAACCCAGTGGAGCTGAGATAGG 0: 1
1: 0
2: 0
3: 14
4: 132
924389910_924389916 17 Left 924389910 1:243543153-243543175 CCCACATGGTAGCTCCTGGCTGT 0: 1
1: 0
2: 1
3: 60
4: 668
Right 924389916 1:243543193-243543215 ACTGGGCATGTCTAACCCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 95
924389910_924389913 -1 Left 924389910 1:243543153-243543175 CCCACATGGTAGCTCCTGGCTGT 0: 1
1: 0
2: 1
3: 60
4: 668
Right 924389913 1:243543175-243543197 TCTTACTATCACCTTTACACTGG 0: 1
1: 0
2: 1
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924389910 Original CRISPR ACAGCCAGGAGCTACCATGT GGG (reversed) Intronic
900629958 1:3629447-3629469 ACAGGCATGAGCCACCATGCTGG - Exonic
901582913 1:10260586-10260608 ACAGGCATGAGCCACCATGCTGG - Intronic
901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG + Intergenic
902197069 1:14805614-14805636 ACAGTCATGAGCCACCATGCTGG - Intronic
902233061 1:15040487-15040509 ACAGGCATGAGCCACCATGCTGG - Intronic
902325111 1:15694897-15694919 ACAGGCAGGCACCACCATGTTGG + Intronic
902427379 1:16335150-16335172 ACAGACACAAGCCACCATGTTGG - Intronic
902978950 1:20109482-20109504 ACACCCAGGGACTACCAGGTGGG - Intergenic
903435820 1:23348391-23348413 ACAGGCATGAGCCACCATGCTGG - Intergenic
903497094 1:23776666-23776688 ACAGGCATGAGCCACCATGCTGG + Intergenic
903702037 1:25256425-25256447 ACAGGCATGAGCCACCATGCTGG + Intronic
903870242 1:26428812-26428834 ACAGGCATGAGCCACCATGCTGG + Exonic
904083717 1:27888653-27888675 ACAGGCATGAGCCACCATGCCGG + Intergenic
905719217 1:40182155-40182177 ACAGGCATGAGCCACCATGCCGG - Intronic
907190214 1:52641824-52641846 ACAGGCATGAGCCACCATGCTGG - Intronic
907252240 1:53147208-53147230 GTGGCCAGTAGCTACCATGTTGG + Intergenic
907257585 1:53191459-53191481 AGAGACAGGATTTACCATGTTGG - Intergenic
907545526 1:55256815-55256837 ACAGGCATGAGCCACCATGCTGG + Intergenic
907684285 1:56594844-56594866 ACAGGCATGAGCTACCGTGCCGG + Intronic
908129983 1:61065497-61065519 ACAGGCATGAGCCACCATGTCGG + Intronic
908372277 1:63495081-63495103 ACAGCCAGAAGCCACCATGCAGG + Intronic
908485524 1:64588652-64588674 ACAGGCATGAGCCACCATGCTGG + Intronic
909480511 1:76124821-76124843 ACAGCTAGTAGCTACCATATTGG - Intronic
909665713 1:78130376-78130398 ACAGGCATGAGCTACCATGCCGG + Intronic
910249531 1:85181291-85181313 ACAGGCATGCGCCACCATGTCGG + Intronic
910663638 1:89701003-89701025 ACAGGCATGAGCTACCAGCTTGG - Intronic
910943011 1:92557573-92557595 ACAGGCATGAGCCACCATGAAGG + Intronic
912109553 1:106324259-106324281 ACAGGCATGTACTACCATGTTGG - Intergenic
912344889 1:108955119-108955141 ACAGGCATGAGCCACCATGCTGG + Intronic
912917376 1:113828909-113828931 ACAGGCATGAGCCACCATGCTGG + Intronic
913107956 1:115632223-115632245 GCACCCAGGAGCTTCCATCTTGG + Intergenic
914224085 1:145706028-145706050 ACAGGCATGAGCCACCATGCAGG + Intronic
914799212 1:150947953-150947975 ACAGACACGAGCCACCATGCTGG - Intronic
915150215 1:153824805-153824827 ACAGGCATGAGCCACCATGCCGG - Intronic
915218430 1:154355278-154355300 ACAGGCATGAGCCACCATGCCGG - Intergenic
915220570 1:154371289-154371311 ACAGTCAGTAGGTACCATGCTGG - Intergenic
915452456 1:156015702-156015724 ACAGGCATGAGCCACCATATGGG + Intronic
916092632 1:161319721-161319743 ACAGGCATGAGCTACCACGCCGG + Intronic
917399315 1:174629662-174629684 ACAGGCATGTGCTACCATGCCGG + Intronic
918256778 1:182755785-182755807 ATAGCCAGGATCTAGTATGTAGG + Intergenic
918438133 1:184537790-184537812 ACAGGCATGCGCTACCATGCCGG + Intronic
919394575 1:197028742-197028764 ACAAGCATAAGCTACCATGTGGG - Intergenic
919491352 1:198209776-198209798 ACAGGTATGAGCTACCATGCTGG + Intronic
920241971 1:204559191-204559213 ACAGGCAGGAGCCACCATACTGG + Intergenic
920330116 1:205201179-205201201 ACAGGCATGAGCCACCATGATGG + Intronic
920341964 1:205280812-205280834 ACAGGCATGAGCCACCATGCTGG - Intergenic
920362075 1:205425964-205425986 AGTGCCTGGAGCTACCATGGAGG + Intronic
921253857 1:213322027-213322049 ACAGGCATGAGATACCATGCTGG - Intergenic
921617376 1:217285407-217285429 ACAGGCATGAGCCACCATGCTGG + Intergenic
922109664 1:222544639-222544661 ACAGGCATGAGCCACCATGTCGG + Intronic
922185393 1:223270008-223270030 ACATCCAGGAGCTAGGAGGTGGG + Intronic
922461275 1:225816014-225816036 ACAGGCATGAGCCACCATGCCGG - Intronic
924049349 1:240064588-240064610 ACAGACATGAGCCACCATGCTGG + Intronic
924389910 1:243543153-243543175 ACAGCCAGGAGCTACCATGTGGG - Intronic
1063448546 10:6135644-6135666 ACAGACATGAGCCACCATGCCGG + Intergenic
1063569238 10:7199253-7199275 ACAGGCATGAGCCACCATGCTGG + Intronic
1063605376 10:7518791-7518813 ACAGGCATGAGCTACCACGCAGG - Intergenic
1063725167 10:8629061-8629083 ACAGGCATGAGCCACCATGCTGG + Intergenic
1063900139 10:10724377-10724399 ACAGGCATGAGCCACCATGCTGG - Intergenic
1064392890 10:14956785-14956807 ACAGGCAGGAGCCACCAGGATGG - Intergenic
1064421358 10:15193577-15193599 ACAGGCATGAGCCACCATGCTGG + Intergenic
1064471871 10:15643556-15643578 ACAGGCATGAGCCACCATGATGG + Intronic
1064997893 10:21312635-21312657 ACAGGCATGTGCTACCATGCTGG - Intergenic
1065091768 10:22242697-22242719 ACAGTCATGAGCTACTATGCTGG - Intergenic
1065092184 10:22246010-22246032 ACAGGCATGAGCCACCATGCCGG - Intergenic
1066128868 10:32370694-32370716 CCAGCTAGTAGCTACCATATCGG - Intronic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1066486860 10:35854188-35854210 ACAGGCATGAGCCACCATGCCGG + Intergenic
1068755755 10:60650805-60650827 ACAGGCATGAGCTACCATGCTGG - Intronic
1069011688 10:63381227-63381249 ACAGGCATGAGCCACCATGCTGG - Intronic
1069473291 10:68711806-68711828 ACAGGCATGAGCCACCATCTCGG - Intergenic
1069498799 10:68930926-68930948 ACAGGCATGAGCCACCATGCTGG + Intronic
1069546068 10:69329818-69329840 ACAGGCAGGAGACACCATGCTGG - Intronic
1069801995 10:71087485-71087507 AAAGCCAGGAGCTAGGATGGTGG + Intergenic
1070198662 10:74182638-74182660 ACAGGCATGAGCTACCGTGCCGG + Intronic
1070486744 10:76938971-76938993 ATAGCCAGTGGCTACCATATTGG - Intronic
1070521835 10:77260430-77260452 ACAGACATGAGCCACCATGCCGG - Intronic
1070840700 10:79485963-79485985 ACAGGCATGAGCTACCATGCTGG - Intergenic
1071269127 10:83990956-83990978 ACAGGCATGAGCCACCACGTTGG - Intergenic
1071270333 10:84001050-84001072 ACAGGCATGAGCCACCATGCTGG + Intergenic
1071304475 10:84286195-84286217 ACAGGCATGAGCCAACATGTGGG - Intergenic
1071596614 10:86932521-86932543 ACAGGCATGAGCCACCATGCTGG + Exonic
1071616182 10:87078862-87078884 ACAAGCATGAACTACCATGTTGG - Intronic
1072066201 10:91873914-91873936 ACAGGCATGAGCCACCATGCTGG - Intergenic
1072588069 10:96800046-96800068 ACAGGCATGAGCCACCATGCTGG - Intergenic
1072802427 10:98402175-98402197 ACAGCCATGTGCCACCATGTTGG - Intronic
1073760609 10:106624635-106624657 ACAGGCATGAGCCACCATGCCGG + Intronic
1074052967 10:109896544-109896566 ACAGGCAAGAGCCACCATGCTGG + Intronic
1076610262 10:131721768-131721790 ACAGGCATGAGCCACCATGCCGG + Intergenic
1078401474 11:11031510-11031532 ACAGGCATGAGCCACCATGCCGG - Intergenic
1078649283 11:13172414-13172436 ACAGGCATGAGCTACCACGCTGG - Intergenic
1078818602 11:14852330-14852352 ACAGGCATGAGCTACCATGCCGG + Intronic
1080010933 11:27458813-27458835 ACAGGCATGAGTTACCATGCCGG + Intronic
1080804631 11:35641266-35641288 ACACAGAGGAGCTACCATTTTGG + Intergenic
1081456086 11:43224269-43224291 ACACCCAGGATCATCCATGTTGG - Intergenic
1081571256 11:44292817-44292839 ACAGGCATGAGCTACCATGCGGG - Intronic
1081662679 11:44897536-44897558 GCACCCAGGAGCTGCCATCTGGG + Intronic
1081819769 11:45981107-45981129 ACAGGCATGAGCCACCGTGTTGG - Intronic
1082020745 11:47530968-47530990 ACAGGCATGAGCTACCACGCCGG - Intronic
1082022101 11:47543125-47543147 ACAGGCATGAGCTACCATGCTGG - Intronic
1084658668 11:70534530-70534552 ACAGACAGAAGCCACCATGGAGG + Intronic
1085080689 11:73631426-73631448 ACAGGCATGAGCCACCATGCTGG + Intergenic
1085146845 11:74208035-74208057 ACAGGCATGAGCCACCATGCCGG - Intronic
1085243685 11:75079865-75079887 ACAGCCAACAGTTACCCTGTGGG - Intergenic
1085624534 11:78061910-78061932 ACAGGCATGAGCCACCATGCCGG + Intronic
1086220208 11:84433838-84433860 ACAGGCATGAGCCACCATGCTGG - Intronic
1087738910 11:101865634-101865656 ACAGGCATGAGCCACCATGCCGG - Intronic
1087809910 11:102599294-102599316 ACAGGCATGAGCCACCATGCCGG + Intronic
1087962711 11:104372177-104372199 ACAGGCATGAGCTACCATGCCGG - Intergenic
1088266207 11:107990296-107990318 ACAGACATGAGCCACCATGCCGG + Intergenic
1088588806 11:111383471-111383493 ACAGGCATGAGCCACCATGCTGG - Intronic
1089260439 11:117220518-117220540 ACAGGCATGAGCCACCATGGGGG + Intronic
1089420488 11:118329763-118329785 ACAGGCATGAGCCACCAGGTAGG - Intergenic
1089856397 11:121548841-121548863 ACAGGCGTGAGCTACCATGCCGG + Intronic
1090021008 11:123128372-123128394 ACAGGCCTGAGCTACCATGCTGG - Intronic
1090201169 11:124857667-124857689 ACAGGCATGAGCCACCATGCTGG - Intergenic
1090343585 11:126047998-126048020 ACAGGCAGGAGCCACCACGACGG - Intronic
1092175053 12:6398596-6398618 ACAGGCATGAGCTACCGTGCCGG + Intergenic
1092657776 12:10705367-10705389 ACAGGCATGAGCCACCACGTTGG + Intronic
1093029445 12:14274711-14274733 ACAGGCATGAGCCACCATGCCGG + Intergenic
1093472955 12:19524300-19524322 ACAGGCACGTGCTACCATGCCGG + Intronic
1095158833 12:38891587-38891609 ACAGGCAGGCGCCACCATGCCGG + Intronic
1095447911 12:42300779-42300801 ACAGGCATGAGCCACCATGCTGG - Intronic
1096065451 12:48736125-48736147 ACAGGCGTGAGCTACCATGGAGG - Intergenic
1097677017 12:62613787-62613809 ACAGGCACGAGCCACCATGCCGG + Intergenic
1097833650 12:64251694-64251716 ATAGGCATGAGCTACCATGCCGG - Intergenic
1097907721 12:64937628-64937650 ACAAACAGGAGCTAGCCTGTGGG - Intergenic
1098121623 12:67246588-67246610 ACAGGCATGAGCCACCATGCTGG + Intergenic
1098320334 12:69237627-69237649 ACAGGCATGAGCCACCATGCTGG + Intergenic
1099077966 12:78135703-78135725 ACAGCCAGTAGGTACACTGTAGG - Intronic
1099522282 12:83679590-83679612 ACAGGCATGAGCCACCATGCTGG - Intergenic
1099947750 12:89264229-89264251 ACAGCCAGACACTACCATGTTGG - Intergenic
1099996475 12:89784798-89784820 ATGGCCAGTAGCTACCATATTGG + Intergenic
1100080769 12:90847290-90847312 ACAGGCATGAGCCACCATGCGGG + Intergenic
1101004017 12:100384321-100384343 ACAGGCATGAGCCACCATGCCGG - Intronic
1101428467 12:104606924-104606946 ACAGGCACGAGCCACCATGCCGG - Intronic
1102479238 12:113209658-113209680 ACAGACAGGAGCCACCGTGCCGG + Intronic
1102684533 12:114714374-114714396 ACAGGCATGAGCCACCATGCCGG + Intergenic
1103141205 12:118549907-118549929 AAAGCCAGGAGCTGCCAGGGAGG + Intergenic
1103373441 12:120437030-120437052 ACAGCCATGAGCCACCACGCTGG + Intergenic
1103406544 12:120679893-120679915 TCAGGCATGAGCTACCATGCTGG - Intergenic
1103544157 12:121687802-121687824 ACAGGCATGAGCCACCATGCCGG - Intergenic
1103623379 12:122201855-122201877 ACAGGCGTGAGCCACCATGTTGG - Intronic
1103717251 12:122952073-122952095 ACAGCAAGGAGGGACCATCTTGG + Intronic
1103742680 12:123101779-123101801 ACAGGCATGAGCCACCATGCCGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103942784 12:124510045-124510067 GCAGCCAGGAGCCACCACATGGG + Intronic
1104279213 12:127358506-127358528 ACAGACATGAGCTACCACGCAGG + Intergenic
1104924964 12:132309232-132309254 ACAGCCTGGATCTGCCATGCGGG + Intronic
1105044341 12:132989310-132989332 ACAGCCATGAGCCACCGTGCCGG + Intronic
1105332748 13:19433225-19433247 ACAGGCGGGAGCCACCATGATGG - Intronic
1105661413 13:22499407-22499429 ACAGGCATGAGCCACCATGCCGG + Intergenic
1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG + Intergenic
1105920898 13:24962496-24962518 ACAGGCGGGAGCCACCATGATGG - Intergenic
1105991966 13:25631340-25631362 GCAGCCAGTAGCTACCATATTGG + Intronic
1106112361 13:26787990-26788012 ACAGTCTGTAGATACCATGTGGG + Intergenic
1106468783 13:30036576-30036598 TGACCGAGGAGCTACCATGTTGG - Intergenic
1106723240 13:32456995-32457017 ACAGGCATGAGCCACCATGTTGG - Intronic
1107035698 13:35900519-35900541 ACAGGCATGAGCCACCATGCTGG + Intronic
1107891005 13:44914346-44914368 ACAGACATGAGCCACCATGCCGG + Intergenic
1107935525 13:45342144-45342166 ACAGGCATGAGCTACCATGCAGG - Intergenic
1107946999 13:45428017-45428039 ACAGGCATGAGCCACCATGCCGG + Intergenic
1109184529 13:59252847-59252869 ACAGGCATGAGCCACCATGCAGG - Intergenic
1109300624 13:60586695-60586717 ACAGGCATGAGCCACCATGCTGG - Intergenic
1110844920 13:80183305-80183327 ACAGGCATGAGCCACCATGATGG - Intergenic
1111497815 13:89076113-89076135 ACAGGCATGAGCTACCAAGTGGG + Intergenic
1111682489 13:91460576-91460598 ACAGGCATGAGCCACCATGCTGG + Intronic
1113872856 13:113572849-113572871 ACAGGCATGAGCCACCATGCTGG - Intergenic
1114214820 14:20648950-20648972 ACAGACATGAGCTACCGTGCTGG + Intergenic
1114276784 14:21154035-21154057 ACAGGCATGAGCCACCATGCTGG - Intergenic
1114299688 14:21363973-21363995 CCAGCCAAGAGCTACAATTTGGG + Intronic
1116379641 14:44249623-44249645 ACAGGCATGAGCCACCATGCCGG - Intergenic
1117309544 14:54507988-54508010 ACAGGCATGAGCCACCATGCTGG + Intergenic
1117425364 14:55589584-55589606 ACAGGCATGAGCCACCATGCTGG + Intronic
1117655050 14:57946750-57946772 ACAGGCATGAGCCACCACGTTGG + Intronic
1117853137 14:59996087-59996109 ACAGGCAGGTGCCACAATGTGGG + Intronic
1118020050 14:61702149-61702171 ACAGGCAGGAGCCACCGTGCCGG - Intronic
1118117431 14:62796286-62796308 ACAGGCATGAGCCACCATGCTGG + Intronic
1118181137 14:63494616-63494638 ACAGGCATGATCCACCATGTTGG - Intronic
1118189456 14:63567344-63567366 ACAGGCATGAGCCACCATGCCGG - Intergenic
1118190888 14:63579063-63579085 ACAGGCATGAGCCACCATGTCGG + Intergenic
1118480010 14:66155075-66155097 ACAGGCAGGAGCCACCAGGCCGG + Intergenic
1118868910 14:69725504-69725526 ACAGGCATGAGCCACCATGCTGG - Intergenic
1120988410 14:90354273-90354295 ACAGGCGTGAGCTACCATGCCGG - Intergenic
1121000054 14:90445119-90445141 ACAGGGATGAGCCACCATGTTGG + Intergenic
1121753725 14:96383269-96383291 ACAGGCAAGTGCTGCCATGTTGG - Intronic
1122126160 14:99579750-99579772 GCAGGCAGGAGCTGACATGTGGG - Intronic
1122727763 14:103770235-103770257 ACAGGCATGAGCTACCACCTGGG - Intronic
1122969405 14:105146435-105146457 CCACCCAGGAGCTTCCGTGTGGG + Exonic
1123600837 15:21968266-21968288 ACAGGCATGAGCCACCATGCTGG + Intergenic
1124094441 15:26636092-26636114 CCAGACAGGAACTACCATGCAGG + Intronic
1124454589 15:29829026-29829048 ACAGGCATGAGCCACCATGCCGG + Intronic
1124462183 15:29902757-29902779 ACAGGCATGAGCCACCGTGTCGG - Intronic
1124685383 15:31777673-31777695 CCAGGCAGGGGCTTCCATGTTGG + Intronic
1125097708 15:35873511-35873533 ACAGGCATGAGCCACCATGCCGG + Intergenic
1126152112 15:45532814-45532836 ACAGGCATGAGCTGCCGTGTCGG + Intergenic
1126827350 15:52565299-52565321 ACAGGCAAGAGCCACCCTGTAGG + Intronic
1127048037 15:55048653-55048675 ACAGGCATGAGCCACCATGGTGG - Intergenic
1127068475 15:55264964-55264986 ACAGGCATGAGCCACCATGCCGG - Intronic
1127199326 15:56626200-56626222 ACAGGCATGAGCCACCATGCTGG - Intergenic
1127216677 15:56830675-56830697 ACAGGCATGAGCCACCATGCCGG - Intronic
1127400382 15:58579644-58579666 ACAGCCATGAGCCACTATGCTGG + Intergenic
1128207334 15:65864983-65865005 ACAGACAGGAGCCACCATGCTGG + Intronic
1128725004 15:69981961-69981983 GCAGCCAGGAGCAACCATTTTGG - Intergenic
1128809814 15:70562597-70562619 ACAGGCATGTGCTACCATGCCGG - Intergenic
1129178333 15:73855960-73855982 CCAGCCAGCAGGTACCATGGTGG - Intergenic
1130020302 15:80224883-80224905 ACAGGCAGCCGCCACCATGTGGG + Intergenic
1130325814 15:82878901-82878923 ATAGACAGGAGCCACCATGCTGG + Intronic
1130361165 15:83187744-83187766 ACAGGCATGTGCCACCATGTCGG - Intronic
1130549413 15:84880357-84880379 ACAGGCATGTGCTACCATGCTGG + Intergenic
1130832912 15:87619874-87619896 ACAGGCATGTGCTACCATGCCGG - Intergenic
1131185237 15:90268277-90268299 ACAGGCATGAGCCACCATGCCGG + Intronic
1131670919 15:94618819-94618841 ACAGGCATGAGCCACCATGCTGG + Intergenic
1131747102 15:95460571-95460593 ACAGGCATGAGCCACCATGCCGG - Intergenic
1132059399 15:98679180-98679202 ACAGGCATGAGCCACCATGCTGG + Intronic
1132186067 15:99802778-99802800 ACAGGCATGAGCCACCATGCTGG + Intergenic
1132294422 15:100725150-100725172 CCAGCCAGGATCCCCCATGTGGG - Intergenic
1132302137 15:100782479-100782501 ACAGACATGAGCCACCATGCTGG - Intergenic
1132394655 15:101463928-101463950 ACACCCTGGGGCTACCATGGGGG - Intronic
1132429606 15:101749925-101749947 ACAGGCATGAGCCACCATGCTGG - Intergenic
1202972945 15_KI270727v1_random:258086-258108 ACAGGCATGAGCCACCATGCTGG + Intergenic
1133066373 16:3210298-3210320 ACAGGCATGAGCCACCATGCCGG + Intergenic
1133070257 16:3242084-3242106 ACAGGCATGAGCCACCATGCCGG - Exonic
1133135940 16:3712012-3712034 ACAGACATGAGCTACCACGTCGG - Intronic
1133421320 16:5649444-5649466 ACAGGCATGAGCCACCATGCCGG + Intergenic
1133524666 16:6593004-6593026 ACAGACAGGTTTTACCATGTTGG - Intronic
1133647953 16:7781961-7781983 ACAGCCAGGTGCCACCATGCCGG + Intergenic
1133659091 16:7897447-7897469 ACAGGCATGAGCCACCATGCCGG + Intergenic
1134011312 16:10855212-10855234 ACAGGCATGAGCCACCATGCCGG + Intergenic
1134206022 16:12238465-12238487 ACAGCCACGTGCCACCATGCCGG + Intronic
1134743279 16:16567361-16567383 ACAGGCATGAGCCACCATGCCGG - Intergenic
1134924281 16:18145099-18145121 ACAGGCATGAGCCACCATGCCGG + Intergenic
1135096330 16:19567691-19567713 ACAGGCATGAGCTACCATACTGG - Intronic
1135300931 16:21326458-21326480 ACAGACATGAGCCACCATGCTGG + Intergenic
1135417096 16:22276780-22276802 ACAGGCATGAGCCACCATGCTGG - Intronic
1135460959 16:22642562-22642584 CCAGCCAGGGCCTGCCATGTCGG + Intergenic
1135474905 16:22765381-22765403 ACAGCCAGGAGCTAGCAGAGTGG + Intergenic
1135574835 16:23577482-23577504 ACAGGCATGAGCCACCATGCCGG + Intergenic
1135764421 16:25165162-25165184 ACAGCCAGTTGTTATCATGTAGG + Intronic
1135923960 16:26675967-26675989 ACAGCTAGGAGCTCCCAACTTGG + Intergenic
1135946839 16:26872784-26872806 ACAGCCAGGAGCAACTGTATTGG - Intergenic
1135984423 16:27173559-27173581 ACAGGCATGAGCCACCATGCCGG - Intergenic
1136785965 16:32934375-32934397 ACAGGCATGAGCCACCATGCTGG + Intergenic
1137339230 16:47583071-47583093 ACAGCCATGAGCCACCACGCCGG + Intronic
1137501201 16:49013065-49013087 CCAGCCAGGAGCCACAGTGTGGG + Intergenic
1137784093 16:51123341-51123363 ACAGGCATGTGCCACCATGTTGG + Intergenic
1137970156 16:52976707-52976729 ACAGCCAGGAGGGAGCATATAGG - Intergenic
1138167801 16:54819142-54819164 ACAGGCATGTGCCACCATGTCGG - Intergenic
1138241236 16:55428743-55428765 ATAGCCAGGTGCCAACATGTAGG + Intronic
1139648546 16:68349615-68349637 ACAGACATGTGCCACCATGTCGG - Intronic
1139823617 16:69739980-69740002 ACAGGCATGAGCTACCATGCCGG - Intergenic
1140388362 16:74562749-74562771 ACAGGCATGAGCTACCGTGCTGG + Intronic
1140522464 16:75593660-75593682 ACAGGCATGAGCCACCACGTCGG - Intergenic
1140758691 16:78091831-78091853 ACAGGCATGAGCTACCTTGCAGG - Intergenic
1141072065 16:80966166-80966188 AGACCCAGGAGCTACCTTGAAGG - Intergenic
1141217460 16:82038489-82038511 ACAGGCACGTGCTACCACGTTGG + Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1141957268 16:87381359-87381381 ACACCCACTAGCTACCATTTAGG + Intronic
1143444759 17:7001086-7001108 ACAGGCATGTGCCACCATGTGGG + Intronic
1143507045 17:7372654-7372676 ACAGGCATGAGCCACCATGCTGG + Intergenic
1143626581 17:8113881-8113903 ACAGGCAGGTGCCACCATGCCGG - Intronic
1145256486 17:21326463-21326485 ACAGGCACGAGCTACCACGCCGG - Intergenic
1145753240 17:27370184-27370206 ACAGGCATGAGCTACCATGCTGG + Intergenic
1145992720 17:29088759-29088781 ACAGGCATGAGCCACCATGCTGG - Intronic
1146884479 17:36461994-36462016 CCAGCCAAGAGGTAACATGTTGG + Intergenic
1146998893 17:37345934-37345956 ACAGGCATGAGCCACCATGCTGG - Intronic
1147931070 17:43981762-43981784 ACAGGCATGAGCCACCATGCTGG + Intronic
1148654399 17:49272480-49272502 ACAGCCTGGAGCTCTCAGGTAGG + Intergenic
1148809717 17:50282624-50282646 ACAGGCATGAGCTACCGTGTTGG - Intergenic
1149431840 17:56600434-56600456 AGGGCCATGAGCTACCATGTAGG - Intergenic
1149904943 17:60517250-60517272 ACAGGCGTGAGCCACCATGTTGG + Intronic
1150074585 17:62181708-62181730 ACAGACATGAGCCACCATGCTGG - Intergenic
1150290243 17:63977040-63977062 ACAGCAAGCAGCTTCCATGGAGG - Intergenic
1150546565 17:66164579-66164601 ACAGGCATGAGCTACCATGCTGG - Intronic
1150702211 17:67457662-67457684 ACAGGCAGGAGCCACCACGCTGG + Intronic
1150721103 17:67615044-67615066 ACAGGCTGGGGCTAGCATGTGGG - Intronic
1150799971 17:68273495-68273517 ACAGGCATGAGCCACCATGCTGG + Intronic
1151189416 17:72387247-72387269 ACAGGCATGAGCCACCATGCTGG - Intergenic
1151455535 17:74223507-74223529 ACAGGCATGAGCCACCATGCTGG + Intronic
1151633016 17:75324084-75324106 ACAGGCATGAGCCACCATGCCGG + Intronic
1151777170 17:76213291-76213313 ACAGGCATGAGCCACCATGCCGG - Intronic
1151874434 17:76858761-76858783 ACAGGCATGAGCCACCATGCTGG + Intergenic
1151937793 17:77273889-77273911 AGAGCCCGGAGCTACCAAGTGGG - Intergenic
1152432381 17:80256184-80256206 ACAGGCATGAGCCACCATGCAGG + Intergenic
1152483278 17:80570735-80570757 ACAGGCGTGAGCTACCATGCTGG + Intronic
1152516513 17:80827935-80827957 ACAGCCTGGCCCTACCATGCAGG - Intronic
1152790535 17:82276389-82276411 ACACGCATGAGCTACCATGCCGG + Intergenic
1153015542 18:579757-579779 ACAGGCATGAGCTACCAAGCCGG - Intergenic
1153665779 18:7366864-7366886 GCTGCCAGGAACTACCCTGTTGG - Intergenic
1154369721 18:13748801-13748823 ACAGGCATGAGCCACCATGCCGG - Intronic
1155186577 18:23392212-23392234 ACAGGCATGAGCCACCATGCTGG + Intronic
1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG + Intronic
1157246941 18:46062789-46062811 ACAGGCAGGAGCCACCATCCCGG + Intronic
1157980503 18:52374166-52374188 ACAGACATGAGCCACCATGCTGG + Intronic
1158282516 18:55842938-55842960 ACAGGCATGAGCCACCATGCCGG - Intergenic
1158611728 18:58946547-58946569 ACAGGCATGAGCCACCATGCTGG + Intronic
1158665234 18:59426728-59426750 ACAGGCACGAGCCACCATGCCGG - Intergenic
1159211310 18:65326205-65326227 ACATCCAGGATCTAACATGCTGG - Intergenic
1161416257 19:4148698-4148720 ACAGGCGTGAGCTACCATGCGGG + Intergenic
1161623539 19:5312071-5312093 ACAACCAGGAGATGTCATGTGGG - Intronic
1161834174 19:6633929-6633951 ACAGTCATGAGCCACCATGCCGG - Intergenic
1161966511 19:7551821-7551843 ACAGGCATGAGCCACCATGACGG - Intronic
1162076508 19:8191432-8191454 ACAGGCATGAGCCACCATGCTGG + Intronic
1162217249 19:9146704-9146726 ACAGGCATGAGCCACCATGCTGG + Intronic
1162350628 19:10146980-10147002 ACAGACATGAGCCACCATGCTGG - Intronic
1162546944 19:11336448-11336470 ACAGGCGGGAGCTACCATGCTGG + Intronic
1163231758 19:16007900-16007922 ACAGGCATGAGCCACCATGCCGG + Intergenic
1163305654 19:16476848-16476870 ACAGGCGTGAGCTACCATGCCGG - Intergenic
1163483626 19:17573555-17573577 ACAGGCATGTGCCACCATGTCGG - Intronic
1163806355 19:19400869-19400891 ACAGGCAGGAGCCACCACATCGG - Intronic
1164027245 19:21363918-21363940 ACAGACATGAGCCACCATGCCGG - Intronic
1165537564 19:36462262-36462284 ACAGACATGAGCCACCATGCCGG + Intronic
1165801756 19:38556204-38556226 ACAGGCACGAGCCACCATGCCGG - Intronic
1166523027 19:43494284-43494306 ACAGGCATGAGCCACCATGCTGG + Intronic
1166711136 19:44938156-44938178 ACAGGCACGAGCCACCATGCTGG + Intergenic
1167058507 19:47128761-47128783 ACAGGCATGAGCCACCATGCCGG + Intronic
1167073151 19:47232073-47232095 ACAGGCATGAGCCACCGTGTCGG - Intronic
1167090206 19:47338875-47338897 ACAGGCGTGAGCCACCATGTCGG - Intronic
1167098646 19:47390396-47390418 ACAGGCATGAGCCACCATGCTGG + Intergenic
1167323221 19:48809099-48809121 ACAGGCATGAGCCACCATGCTGG - Intronic
1167393940 19:49214845-49214867 AGAGCCAGGGGCTACCAGGGTGG - Intergenic
1167639708 19:50674069-50674091 ACAGGCATGAGCCACCGTGTTGG + Intronic
1167847846 19:52178999-52179021 ACAGGCATGAGCCACCATATTGG + Intergenic
1167959226 19:53092588-53092610 ACAGGCGTGAGCTACCATGCTGG + Intronic
1168042596 19:53770211-53770233 ACAGGCAGGAGCCACCGTGCTGG - Intergenic
1168217094 19:54934341-54934363 ACAGGCAGGAGCCACCGTGCCGG + Intronic
1168639573 19:58021730-58021752 ACAGGCTGGAGCCACCATGCCGG + Intergenic
926011102 2:9408614-9408636 ACAGGCATGAGCCACCATGTGGG + Intronic
927369163 2:22334587-22334609 GCAGGCATGAGCCACCATGTCGG + Intergenic
927778480 2:25920689-25920711 ACAGGCATGATCTACCATGCTGG - Intergenic
927942670 2:27115009-27115031 ATAGGCATGAGCTACCATGCTGG + Intronic
928225891 2:29447733-29447755 AAAGCCAGGAGCTACCTGGAGGG - Intronic
928302516 2:30138686-30138708 ACAGGCAGGAGCCACCGTGCTGG - Intergenic
929239255 2:39636925-39636947 ACAGGTATGGGCTACCATGTCGG + Intergenic
929506212 2:42530211-42530233 ACAGGCAGGAGCCACCATGCCGG - Intronic
929984407 2:46713077-46713099 ACAGGCATGAGCCACCATGCTGG - Intronic
930007753 2:46911643-46911665 ACAGGCACGAGCCACCATGCCGG - Intronic
930768108 2:55105504-55105526 ACAGGCATGAGCCACCATGCTGG + Intronic
931000884 2:57781064-57781086 ACAGGCATGAGCCACCATGCCGG - Intergenic
931267601 2:60674331-60674353 ACAGGCATGAGCCACCATGCTGG - Intergenic
931269134 2:60686530-60686552 ACAGGCATGAGCCACCATGCTGG + Intergenic
932730012 2:74213044-74213066 ACAGACATGAGCCACCATGCCGG + Intronic
932768313 2:74485298-74485320 ACAGGCATGAGCCACCATGCCGG + Intronic
934161104 2:89250460-89250482 ACAGCCACAAGCCACCATCTTGG + Intergenic
934206173 2:89931973-89931995 ACAGCCACAAGCCACCATCTTGG - Intergenic
934637437 2:96003196-96003218 ACAGCAAGAAGGTACCATCTTGG + Intergenic
934752712 2:96804038-96804060 ACAGGCAGGTGCCACCATGCTGG + Intronic
934796217 2:97102209-97102231 ACAGCAAGAAGGTACCATCTTGG - Intergenic
935325630 2:101934030-101934052 ACAGGCATGAGCCACCATGCAGG - Intergenic
935462585 2:103355518-103355540 ACAGGCATGAGCCACCATGCCGG - Intergenic
936034996 2:109104068-109104090 ACAGGCATGAGCCACCATTTCGG + Intergenic
936874801 2:117175442-117175464 ACAGGCATGTGCTACCACGTCGG - Intergenic
937054172 2:118917516-118917538 ACAGGCATGAGCCACCATGTTGG + Intergenic
938022947 2:127920975-127920997 ACAGGCATGAGCCACCATGCTGG + Intergenic
938153890 2:128911057-128911079 ACAGGCATGAGCCACCATGCTGG + Intergenic
938609133 2:132928842-132928864 ACAGGCATGAGCCACCACGTAGG - Intronic
938684287 2:133721890-133721912 ACAGCAAGAAGCCACCATCTAGG + Intergenic
940013417 2:149078728-149078750 ACAGGCATGAGCCACCATGCTGG - Intronic
940236095 2:151512308-151512330 ACAGGCATGAGCCACCATGCCGG + Intronic
941063359 2:160872919-160872941 ACAGGCATGAGCCACCATGCTGG + Intergenic
942064124 2:172254047-172254069 AGGACCAGGAGCTGCCATGTGGG - Intergenic
942178874 2:173360751-173360773 ACAGCCAAGAGCCACCTTGCTGG + Intronic
942339408 2:174927332-174927354 ACAGGCATGAGCCACCATGCTGG + Intronic
943890646 2:193282141-193282163 ACAGGCATGAGCCACCATGCTGG + Intergenic
944695809 2:202199410-202199432 ACAGCCACGGGCCACCATGCTGG + Intergenic
945059232 2:205893922-205893944 ACAGACAGGTTTTACCATGTTGG - Intergenic
945523013 2:210852712-210852734 ACAGCCACGTGCCACCATGCTGG - Intergenic
945710318 2:213286871-213286893 ACAGCCAGGATCCATCTTGTGGG + Intronic
946363104 2:219231013-219231035 ACAGGCATGAGCCACCGTGTCGG + Intronic
947029211 2:225773675-225773697 ATGGCTAGTAGCTACCATGTTGG - Intergenic
947103630 2:226647039-226647061 ACAGGCATGAGCCACCATGCTGG + Intergenic
947237458 2:227957481-227957503 TCAGCCTGAAACTACCATGTTGG - Intergenic
947507619 2:230721152-230721174 ACAGGCACGAGCCACCATGCTGG - Intronic
947566258 2:231195780-231195802 ACAGGCATGAGCCACCATGCAGG + Intergenic
947586315 2:231359039-231359061 ACAGCCAGGAGCTAGGAGATGGG - Intronic
948719013 2:239884332-239884354 ACCACGAGGAGCTTCCATGTGGG + Intergenic
948784021 2:240341519-240341541 ACAGACAGGAGCTGCCTTCTTGG - Intergenic
948926341 2:241101204-241101226 ACAACCAGGAGGTGCCATCTGGG + Intronic
1168912516 20:1460784-1460806 ATAGCTAGTAGCTACCTTGTTGG + Intronic
1169854989 20:10092656-10092678 ACAGGCATGAGCCACCATGCTGG - Intergenic
1170300985 20:14884398-14884420 ACAGCCAGCACCAGCCATGTTGG - Intronic
1170788606 20:19489629-19489651 CCAGCCAGGAACTACAATTTGGG + Intronic
1170810008 20:19666705-19666727 ACAGGCATGAGCCACCATGCCGG - Intronic
1171413184 20:24960154-24960176 ACAGCCAGCAGCAGCCATGCCGG + Intergenic
1171497526 20:25566650-25566672 ACAGGCATGAGTTACCATGCCGG - Intronic
1172288845 20:33760441-33760463 ATAGTCAGTAGCTACCATATTGG - Intronic
1173095968 20:40028673-40028695 ACAGGTATGAGCTACCATGCCGG - Intergenic
1173831816 20:46094252-46094274 ACAGGCATGTGCTACCATGCCGG + Intergenic
1174297255 20:49557448-49557470 ACAGACATGTGCTACCATGCTGG - Intronic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1174515558 20:51089564-51089586 ACAGGCAGTAGCTGCCCTGTGGG - Intergenic
1174847282 20:53954862-53954884 CCAGCCAAGAGATACCACGTAGG + Intronic
1174864784 20:54125269-54125291 ACAGGCAGGAGCTACCATGCTGG - Intergenic
1175317010 20:58055457-58055479 GCAGCCAGGCACTAACATGTGGG - Intergenic
1176308630 21:5137553-5137575 ACAGGCGGGAGCCACCATGCAGG - Intronic
1176365179 21:6028450-6028472 GCAGCCAGGAGCTAACTTGGAGG - Intergenic
1176740275 21:10595317-10595339 ACAGGCGGGAGCCACCATGATGG + Intronic
1177572419 21:22904358-22904380 ACAGGCATGAGCCACCATGCCGG - Intergenic
1177690840 21:24505345-24505367 ACAGGCGTGAGCTACCATGCCGG + Intergenic
1177861303 21:26457820-26457842 ACAGACAAGAGCCACTATGTAGG - Intergenic
1178504284 21:33150595-33150617 ACAGGCATGAGCCACCATGCCGG + Intergenic
1178833659 21:36077884-36077906 ACAGCCCAGAGCAACCATGCCGG + Intronic
1178946967 21:36956773-36956795 ACAGCCATGAGCCACCATTCTGG - Intronic
1179758339 21:43510095-43510117 GCAGCCAGGAGCTAACTTGGAGG + Intergenic
1179848429 21:44124479-44124501 ACAGGCGGGAGCCACCATGCAGG + Intronic
1180240688 21:46502722-46502744 ACAGGTGTGAGCTACCATGTTGG + Intronic
1181453266 22:23038044-23038066 ACAGCCAGGTGGAACCATCTGGG + Intergenic
1181664460 22:24382742-24382764 ACAGACAGGTGCCACCATGCTGG - Intronic
1182032833 22:27173597-27173619 ACAGACATGAGCTATCATGGTGG + Intergenic
1182433781 22:30317129-30317151 ACAGGCATGAGCCACCATGCCGG - Intronic
1182821242 22:33218204-33218226 ACAGGCATGAGCCACCATGCTGG + Intronic
1183128954 22:35814430-35814452 ACAGGCATGAGCCACCATGCAGG - Intronic
1183284944 22:36956099-36956121 ACAGGCATGAGCCACCATGCTGG - Intergenic
1183467878 22:37988981-37989003 ACAGACAGAAGCTACCCTGTGGG + Intronic
1183730171 22:39614122-39614144 ACAGGCATGAGCCACCATGCTGG + Intronic
1184184448 22:42855731-42855753 ACAGGCATGAGCCACCATGCTGG - Intronic
1184612134 22:45611258-45611280 ACAGGCAAGAGCCACCATGCCGG - Intergenic
1185005071 22:48271037-48271059 ACAGTCAGAAGGTGCCATGTAGG - Intergenic
949359459 3:3216185-3216207 ACAGTCATGAGCTACCATGCTGG + Intergenic
949398397 3:3639721-3639743 ACAGGCATGAGCCACCATGCCGG - Intergenic
949502232 3:4691873-4691895 ACAGGCATGAGCCACCACGTTGG - Intronic
949897089 3:8776022-8776044 ACAGGCATGAGCCACCATGCTGG - Intronic
950767872 3:15286820-15286842 ACAGGCATGAGCCACCATGCCGG + Intronic
951438776 3:22697315-22697337 ACAGGCATGAGCTACCATACCGG + Intergenic
951526062 3:23654229-23654251 ACAGACATGAGCCACCATGCTGG - Intergenic
952316248 3:32235216-32235238 ACAGGCATGAGCCACCATGCTGG - Intergenic
952536986 3:34321597-34321619 ACAGGCATGAGCCACCATGCCGG + Intergenic
953264055 3:41369219-41369241 ACAGGCAGGGGCCACCATGCAGG - Intronic
953424601 3:42783471-42783493 ACAGGCATGCGCCACCATGTCGG - Intronic
953633022 3:44636026-44636048 ACAGGCATGAGCCACCATGCCGG - Intronic
954504288 3:51053695-51053717 ACAGGCATGAGCCACCATGCTGG + Intronic
954691445 3:52397669-52397691 CAAGCCAGGGGCTTCCATGTTGG + Intronic
954721823 3:52570997-52571019 ACAGGCATGAGCTACCACGTTGG + Intronic
955227822 3:57075532-57075554 ACAGGCATGAGCCACCATGCCGG - Intronic
955312602 3:57904630-57904652 ACAGGTATGAGCTACCATGCTGG - Intronic
956590811 3:70912732-70912754 ACAGGCAGCCGCTACCATTTCGG - Intergenic
956668773 3:71666658-71666680 ACAGGCAGGAGCCACCGTGCTGG - Intergenic
956854177 3:73259713-73259735 ATAGCTAGTAGCTACCATATTGG + Intergenic
957358023 3:79116792-79116814 AGAGGCATGAGCTACCAGGTCGG + Intronic
957790557 3:84935509-84935531 ACAGGCATGAGCCACCATGCTGG + Intergenic
958626579 3:96632460-96632482 ACAGGCATGAGCCACCATCTCGG + Intergenic
958938950 3:100288935-100288957 ACAGGCATGAGCCACCATGCCGG - Intronic
959012901 3:101098838-101098860 ACAGGCATGAGCCACCATGCCGG + Intergenic
959545262 3:107588437-107588459 CAAGCCAGGAGCTAACGTGTTGG + Intronic
960006855 3:112789710-112789732 ACAGCCAGAGGCAACTATGTGGG - Intronic
960071187 3:113433150-113433172 ACAGGCATGAGCCACCATGCTGG - Intronic
960904364 3:122584852-122584874 ACAGGCATGAGCTACCACGCCGG + Intronic
961824752 3:129593153-129593175 ACAGCCAGGAGCTGGGTTGTAGG - Intronic
962165208 3:133040477-133040499 ACAGGCATGAGCCACCATGCCGG + Intronic
962393786 3:134996461-134996483 ACAGCCATGCGCCACCATGCTGG + Intronic
964095480 3:152926719-152926741 AAAGCCAGGATCTACACTGTGGG - Intergenic
964280904 3:155064012-155064034 ACAGGCATGAGCCACCATGCTGG - Intronic
965971481 3:174561474-174561496 ACCGCCATGAGCCACCATGCCGG + Intronic
966845172 3:184123141-184123163 ACAGGCATGAGCCACCATGCCGG - Intergenic
967025234 3:185558928-185558950 ACAGGCATGAGCCACCATGCTGG - Intergenic
967249808 3:187525397-187525419 ACAGGCCTGAGCTACCATGCCGG + Intergenic
968119887 3:196118680-196118702 ACAGGCATGAGCCACCATGCTGG + Intergenic
968317100 3:197734290-197734312 ACAGGCATGAGCGACCATGCCGG - Intronic
969109586 4:4835276-4835298 ACACCCAGAAGCAACCATGGGGG + Intergenic
969628163 4:8318857-8318879 ACAGGCATGTGCTACCATGCCGG - Intergenic
969908559 4:10421223-10421245 ACAGGCATGAGCCACCATGCTGG + Intergenic
970403493 4:15740331-15740353 ATAGGCATGAGCCACCATGTCGG + Intergenic
971005160 4:22365310-22365332 ACAGTCATGAGCCACCATGCTGG - Intronic
971414261 4:26409288-26409310 ACAGGCATGAGCCACCATGCCGG - Intronic
972469071 4:39386078-39386100 ACAGGCATGAGCCACCATGTAGG + Intergenic
972657096 4:41074870-41074892 ACAGGCATGAGCCACCATGCTGG - Intronic
972663970 4:41146047-41146069 ACAGGCATGAGTCACCATGTTGG - Intronic
972806782 4:42536848-42536870 ACAGGCATGAGCCACCATGCCGG - Intronic
973623029 4:52746294-52746316 ACAGCCATGAGCCACCATACCGG + Intronic
973972601 4:56228483-56228505 ACAGGCATGAGCTACCATCCTGG - Intronic
974034737 4:56808006-56808028 ACAGGCAAGAGCCACCATGCAGG + Intergenic
974484909 4:62492645-62492667 AGAGCCAGGAGGTCCCATCTTGG + Intergenic
976628911 4:87217760-87217782 ACAGGTGTGAGCTACCATGTGGG + Intronic
976724249 4:88200046-88200068 ACAGGCATGAGCCACCATGCCGG - Intronic
977696457 4:99971594-99971616 CCAGCCAGAAGCTATAATGTGGG - Intergenic
978525415 4:109659932-109659954 ACAGGCATGAGCCACCATGCCGG + Intronic
979381217 4:120009119-120009141 ACAGGCATGAGCCACCATGCTGG - Intergenic
980114997 4:128670802-128670824 GGAGCCAGGAGTTCCCATGTGGG - Intergenic
980460435 4:133104242-133104264 ACAGCCACGTGCTACTACGTTGG - Intergenic
980912979 4:139010195-139010217 ACAGGCATAAGCTACCATGCCGG + Intergenic
980985444 4:139690584-139690606 ACACCCAGGAGCTCCCACATAGG - Intronic
981118792 4:141023731-141023753 ACAGCTAGTGGCTACCACGTTGG + Intronic
982490625 4:156025167-156025189 ACAGGCATGAGCCACCATGCCGG - Intergenic
983005994 4:162485895-162485917 ACAGGCATGCGCCACCATGTTGG + Intergenic
983144724 4:164199453-164199475 ACAACCAGGTTTTACCATGTTGG - Intronic
983210858 4:164956340-164956362 ACAGGCATGAGCTTCCATGCCGG + Intronic
983467459 4:168112742-168112764 ACAGGCATGAGCCACCATGCCGG - Intronic
983523978 4:168741541-168741563 ACAGGCATGAGCCACCATGCCGG - Intronic
983558279 4:169077433-169077455 ACAGGCATGAGCCACCATGCCGG - Intergenic
984266574 4:177504683-177504705 ACAGGCATGAGCTACCATGCCGG + Intergenic
984359150 4:178705911-178705933 ACAGGCATGAGCCACCATGCTGG + Intergenic
984668695 4:182456904-182456926 ACAGGCATGAGCCACCATGCCGG - Intronic
984804451 4:183738146-183738168 ACAGGCATGAGCCACCATGCCGG + Intergenic
985587100 5:746137-746159 TCAGCCACGAGCTTCCATGGAGG + Intronic
985601671 5:838320-838342 TCAGCCACGAGCTTCCATGGAGG + Intronic
988158639 5:27490196-27490218 ACAGGCATGAGCCACCATGCTGG - Intergenic
988898251 5:35701835-35701857 ACAGACATGTGCCACCATGTTGG - Intronic
990025254 5:51180038-51180060 ACAGGCATGAGCCACCATGCCGG + Intergenic
990068339 5:51747062-51747084 ACAGGCATGAGCCACCATGCCGG + Intergenic
990333307 5:54748378-54748400 GTAGCCAGGGGCTGCCATGTGGG + Intergenic
990467272 5:56082175-56082197 ACAGACATGAGCCACCATGCAGG + Intergenic
991183346 5:63779891-63779913 ACAGCAAGGAGCTGCCATTCTGG - Intergenic
991291496 5:65037286-65037308 ACAGGCATGAGCCACCATGCTGG + Intergenic
991321332 5:65376553-65376575 ACAGGCATGAGCCACCATGCCGG - Intronic
991706302 5:69361881-69361903 ACAGGCATGAGCCACCATGCTGG + Intronic
991733833 5:69613802-69613824 ACAGGCATGAGCCACCATGCCGG - Intergenic
991810267 5:70468944-70468966 ACAGGCATGAGCCACCATGCCGG - Intergenic
991860434 5:71008344-71008366 ACAGGCATGAGCCACCATGCCGG + Intronic
991913232 5:71582035-71582057 ACAGGCATGAGCCACCATGCTGG + Intergenic
992393392 5:76349810-76349832 ATAGGCAGGAGCCACCATGCTGG + Intronic
993814766 5:92529049-92529071 ACAGACATGAGCCACCATGCTGG + Intergenic
994268183 5:97742866-97742888 ACAGACATGAGCCACCATGCTGG - Intergenic
994439118 5:99779788-99779810 ACAGGCATGTGCTACCATGCTGG + Intergenic
994501284 5:100581474-100581496 ACAGGCATGAGCCACCATGCTGG - Intronic
995292231 5:110469995-110470017 ACAGCCATACTCTACCATGTTGG + Intronic
995462245 5:112416619-112416641 ATAGCCAGTAGCTACCATTATGG - Intronic
995611956 5:113920308-113920330 AAAGACAAGAGCAACCATGTAGG + Intergenic
996375730 5:122805013-122805035 ACAGGCATGAGCCACCATGATGG - Intronic
996711265 5:126545834-126545856 ACAGGCATGAGCCACCATGCTGG - Intronic
996756260 5:126938509-126938531 AAAGCTAGGAGTTAACATGTAGG + Intronic
997175209 5:131768531-131768553 ACAGGCATGAGCCACCATGCTGG - Intronic
997482581 5:134198705-134198727 ACAGGCAGGCGCCACCATGCTGG + Intronic
998116289 5:139540193-139540215 ACAGCCATGAGCCACCACGCCGG + Intronic
998124517 5:139608153-139608175 ACAGCCGTGAGCTACCACGCCGG - Intronic
998457172 5:142282314-142282336 ACAGGCATGAGCCACCATGCCGG - Intergenic
998593111 5:143499048-143499070 AGAGCCAGGATTTACCATCTAGG + Intergenic
998772907 5:145566561-145566583 ACAGGCATGAACCACCATGTGGG - Intronic
999024878 5:148217502-148217524 ACAGGCATGAGCCACCATGTTGG + Intergenic
1000408084 5:160909860-160909882 ACAACCGGCAGCTTCCATGTCGG - Intergenic
1000671807 5:164072582-164072604 ACAGGCATGAGCCACCATGCCGG + Intergenic
1001520942 5:172392493-172392515 ACAGGCATGAGCCACCATGCTGG - Intronic
1001724473 5:173885508-173885530 ACAGTCAGGTGCTGCCAAGTCGG - Intergenic
1001831141 5:174790387-174790409 ACAGGCATGAGCCACCATGCCGG - Intergenic
1002148484 5:177206414-177206436 ACAGGCATGAGATACCATGCTGG + Intronic
1002295090 5:178226040-178226062 ACAGGCATGAGCCACCATGCTGG + Intronic
1002379609 5:178817101-178817123 ACAGGCAGGCGCCACCATGCGGG - Intergenic
1003948783 6:11098707-11098729 ACAGGCATGAGCCACCATGCCGG + Intronic
1004842903 6:19607040-19607062 ACAGGCGTGAGCTACCATGACGG + Intergenic
1005074773 6:21896329-21896351 ACAGGCATGAGCCACCATGCGGG - Intergenic
1005091876 6:22065666-22065688 ACAGGCATGAGCCACCATGCTGG - Intergenic
1005678266 6:28179110-28179132 ACAGGCATGAGCTACCATGCTGG - Intergenic
1006396563 6:33791129-33791151 ACAGCCAGAAGCCACAATGGAGG - Intergenic
1006527683 6:34621580-34621602 ACAGGCATGAGCCACCATGCCGG - Intronic
1006529397 6:34638162-34638184 ACAGGCATGAGCCACCATGCCGG + Intronic
1006585788 6:35110648-35110670 ACAGGCATGAGCTGCCATGCTGG + Intergenic
1006755488 6:36411663-36411685 ACAGGCATGAGCCACCTTGTAGG - Intronic
1006783269 6:36647202-36647224 ACAGGCACAAGCCACCATGTTGG + Intergenic
1007318203 6:41006955-41006977 ACAGGCATGTGCTACCATGCTGG - Intergenic
1007439823 6:41848973-41848995 ACAGGCAGGAGCCACCATGCTGG + Intronic
1007613933 6:43169468-43169490 ACAGGCATGAGCCACCATGCCGG - Intergenic
1007662375 6:43494847-43494869 ACAGGCGTGAGCCACCATGTTGG + Intronic
1008098491 6:47365812-47365834 ACAGGCATGAGCTACCATGCTGG - Intergenic
1008356875 6:50565495-50565517 AGAGCCCAGAGCCACCATGTAGG + Intergenic
1008920068 6:56834084-56834106 ACAGGCATGTGCCACCATGTTGG - Intronic
1010571825 6:77482733-77482755 ACAGGCATGAGCTACCATGCCGG + Intergenic
1011323229 6:86120412-86120434 ACAGGCATGAGCCACCATGCAGG - Intergenic
1011404099 6:86999236-86999258 ACAGGCATGAGCCACCATGCCGG + Intronic
1012397933 6:98821345-98821367 ACAGGCAAGAGCCACCACGTCGG - Intergenic
1013121147 6:107142388-107142410 ACAGCCATGCGCCACCATGCTGG + Intergenic
1013794527 6:113871465-113871487 ACAGGCATGAGCCACCATGCCGG + Intergenic
1014218478 6:118776203-118776225 ACAGGCATGAGCCACCATGCCGG + Intergenic
1015577131 6:134683607-134683629 ACAGTCATGAGCCACCATGCCGG + Intergenic
1015620731 6:135129240-135129262 AGAGGAAGGAGCCACCATGTAGG + Intergenic
1015634447 6:135262028-135262050 ACAGGTATGAGCTACCATGCTGG + Intergenic
1016462235 6:144289074-144289096 ACAGGCATGAGCCACCATGCTGG + Intronic
1016609967 6:145977833-145977855 ATGGCCAGTAGCTACCATATTGG + Intergenic
1016805884 6:148211779-148211801 ACAGCCAGGTGCCATGATGTGGG + Intergenic
1016935958 6:149449713-149449735 ACAGGCATGAGCCACCATGCCGG + Intronic
1016953063 6:149599792-149599814 ACAGGCATGAGCCACCATGCCGG + Intronic
1017018734 6:150123023-150123045 ACAGACATGAGCCACCATGCTGG + Intergenic
1017056604 6:150442326-150442348 ACAGGCATGAGCCACCATGCTGG + Intergenic
1018576040 6:165261359-165261381 AGAGCCAGGAGATACACTGTTGG - Intergenic
1021441430 7:20681401-20681423 ACAGGCATGAGCCACCATGCCGG + Intronic
1021514556 7:21469826-21469848 ACAGTCATGAGCCACCATGCTGG + Intronic
1021711953 7:23424619-23424641 ACAGGCATGAGCTACCCTGCCGG - Intronic
1022292270 7:29016072-29016094 ACAGGCATGAGCCACCATGCTGG - Intronic
1022449180 7:30498693-30498715 ACAGGCATGAGCCACCACGTTGG + Intronic
1022904639 7:34843904-34843926 TCAGCCAGGAGCCACCCAGTGGG - Intronic
1022916990 7:34966565-34966587 ACAGGCATGAGCCACCATGTCGG + Intronic
1023015511 7:35965769-35965791 ACAGGCATGAGCCACCATGCCGG + Intergenic
1023051917 7:36259790-36259812 ACAGGCATGAGCCACCATGCCGG + Intronic
1023337851 7:39188587-39188609 ACAGGCATGAGCCACCATGCTGG + Intronic
1024124637 7:46280085-46280107 ACAGGCATGAGCCACCATGCCGG + Intergenic
1024646556 7:51375905-51375927 ACAGACATGAGCCACCATGCTGG + Intergenic
1024805448 7:53134176-53134198 ACAGGCATGAGCCACCATATGGG - Intergenic
1025000912 7:55313834-55313856 ACAGGCATGAGCCACCATGCTGG - Intergenic
1025932030 7:66003190-66003212 ACAGGCACGCACTACCATGTTGG + Intergenic
1025973728 7:66353036-66353058 ACAGGCATGAGCCACCATGCTGG - Intronic
1025993844 7:66515646-66515668 ACAGGCATGAGCCACCATGCCGG - Intergenic
1026104592 7:67410793-67410815 ACAGCAAGGAGGTACCATCTAGG + Intergenic
1026294404 7:69038601-69038623 ACAGGCAGGAGCCACCATGCTGG + Intergenic
1027714682 7:81654982-81655004 ACAGGCATGAGCCACCATGCTGG + Intergenic
1028963628 7:96777171-96777193 ACAGGCATGAGCCACCATGCTGG - Intergenic
1029250665 7:99233831-99233853 CCAGCCAGGAGCTGCCCTGAGGG - Intergenic
1029370228 7:100145498-100145520 ACAGGCATGAGCCACCATGCCGG - Intergenic
1029447717 7:100623499-100623521 ACAGGCAGGAGCCACCATGCTGG - Intronic
1029623493 7:101705053-101705075 ACAGGCATGTGCCACCATGTTGG - Intergenic
1029812509 7:103063829-103063851 ACAGTCATGAGCCATCATGTGGG + Intronic
1030128976 7:106180531-106180553 ACAGGCATGAGCCACCATGCTGG - Intergenic
1030168672 7:106579939-106579961 ACAGGCATGAGCCACCATGCTGG - Intergenic
1031716740 7:125117596-125117618 ACAGGCATGAGCCACCATGCTGG - Intergenic
1031794291 7:126151885-126151907 ACAGCCAGGTGCCACGATGACGG - Intergenic
1033352309 7:140571436-140571458 ACAGGCATGAGCCACCGTGTTGG + Intronic
1034506071 7:151492426-151492448 AGAGACAGGACCAACCATGTTGG - Intronic
1034523380 7:151638356-151638378 ACAGGCATGAGCCACCATGCCGG - Intronic
1035034171 7:155884533-155884555 AGAACCAGGAGCTACCCTGTAGG - Intergenic
1035105002 7:156434893-156434915 AGAGCCAGGAGCCACCAGATTGG + Intergenic
1035528033 8:329375-329397 CCAGCCACAAGCTACCATCTGGG - Intergenic
1036069093 8:5420323-5420345 ACAGGCAGGAGCCACCACGCCGG - Intergenic
1036426831 8:8652812-8652834 ATAGGCATGAGCTACCATGCTGG + Intergenic
1036455457 8:8902845-8902867 ACAGGCATGAGCCACCATGCTGG - Intergenic
1036809848 8:11860194-11860216 TCAGCCAGGAGCTAGCAACTTGG - Intronic
1037384181 8:18319894-18319916 ACAGGCATGAGCCACCATGCCGG - Intergenic
1037401020 8:18495541-18495563 ACAGCCGTGAGCCACCATGCCGG - Intergenic
1037414729 8:18637879-18637901 ACAGGCATGAGCCACCATGCTGG - Intronic
1037912157 8:22749946-22749968 ACAGGCATGTGCCACCATGTGGG + Intronic
1037915624 8:22771345-22771367 ACAGGCATGCGCCACCATGTCGG - Intronic
1037984075 8:23275883-23275905 ACAGGCATGAGCCACCATGCCGG + Intronic
1038712504 8:29960825-29960847 ACAGGCATGAGCCACCATGTTGG - Intergenic
1038738648 8:30196957-30196979 ACAGGCATGAGCCACCATGCCGG - Intergenic
1038765524 8:30424110-30424132 ACAGGCATGAGCCACCATGCTGG + Intronic
1038791281 8:30670529-30670551 ACAGGCTTGAGCCACCATGTAGG - Intergenic
1038971288 8:32638602-32638624 ACGGGCAGGAGCGACCATGTTGG + Intronic
1039125426 8:34196187-34196209 ACAGGCATGAGCCACCATGCTGG + Intergenic
1039519064 8:38155266-38155288 ACAGGCATGAGCCACCATGCCGG - Intergenic
1039557435 8:38486507-38486529 ACAGGCATGAGCCACCGTGTCGG + Intergenic
1040280207 8:46037083-46037105 ACAGGCATGAGCCACCATGCTGG - Intergenic
1040471777 8:47739760-47739782 ACAGGCGTGAGCCACCATGTCGG + Intergenic
1040881471 8:52209626-52209648 ACAGGCATGAGCCACCATGCCGG - Intronic
1041996704 8:64070207-64070229 ACAGGCATGAGCAACCATGCCGG + Intergenic
1042135407 8:65628579-65628601 ACAGGCATGAGCCACCATGCCGG - Intronic
1042164249 8:65930365-65930387 ACAGGCATGAGCTACCATGCCGG + Intergenic
1042377145 8:68064652-68064674 ACAGGCATGAGCCACCATGCCGG + Intronic
1042540790 8:69905417-69905439 ACAGCCATGAGCCACCCTGCTGG - Intergenic
1042873077 8:73415557-73415579 ACAGGCATGAGCCACCATGCTGG + Intergenic
1043469082 8:80544365-80544387 ACAGGCATGAGCCACCATGCTGG - Intergenic
1044333198 8:90945340-90945362 ACAGGCATGAGCTACCGTGCCGG + Intronic
1044572649 8:93736928-93736950 ACAGGCATGAGCTATCATGCTGG - Intronic
1044628538 8:94257456-94257478 ACAGGCATGAGCCACCATGCCGG + Intronic
1044674769 8:94718480-94718502 ACAGGCATGAGCTACCACGCAGG - Intergenic
1045102039 8:98854413-98854435 ACAGGCATGAGCCACCATGCCGG + Intronic
1045118043 8:99004977-99004999 ACAGGCATGAGCCACCATGCTGG + Intergenic
1045783051 8:105890391-105890413 ACAGGCATGAGCCACCATGTTGG - Intergenic
1045801962 8:106112253-106112275 ACAGGCAGGTGCCACGATGTGGG - Intergenic
1045947437 8:107812117-107812139 ACAGCCAGGACCTACAGTGTTGG + Intergenic
1045980554 8:108181950-108181972 ACAGGCATGAGCCACCATGCTGG + Intergenic
1046105331 8:109658675-109658697 ACAGGCATGAGCCACCATGCCGG - Intronic
1046439522 8:114239961-114239983 ATAGCCATAAGCTACCATGCTGG - Intergenic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1046906799 8:119582290-119582312 CTAGCCAGTAGCTACCATTTTGG + Intronic
1046947676 8:119989275-119989297 ACAGGCAGGAGCCACCGTGCCGG + Intronic
1047769176 8:128016907-128016929 ACAGGCATGAGCCACCATCTTGG - Intergenic
1048273182 8:133045669-133045691 ACAGGCCTGAGCTACCATGCCGG + Intronic
1049367622 8:142248336-142248358 GCATCCTGGAGCTGCCATGTTGG - Intronic
1049746402 8:144265074-144265096 GCAGCCGGGGGCCACCATGTCGG + Intronic
1050614334 9:7386210-7386232 ATAGCCAGGAAGTACAATGTTGG - Intergenic
1051053245 9:12955237-12955259 ACAGGCATGAGCCACCATGCCGG - Intergenic
1051269268 9:15339379-15339401 ACAGGCGCGAGCCACCATGTCGG + Intergenic
1051595834 9:18823710-18823732 ACAGGCACGAGCCACCATGCCGG - Intronic
1052378739 9:27746164-27746186 ACAGCTAGGAGATACCATCTTGG + Intergenic
1052762986 9:32611663-32611685 ACAGCCACGTGCCACCATGCTGG + Intergenic
1053223189 9:36328285-36328307 TGAGACTGGAGCTACCATGTCGG - Intergenic
1053593362 9:39534495-39534517 AAAGCCCGGAGCTCCCGTGTAGG + Intergenic
1053851096 9:42289203-42289225 AAAGCCCGGAGCTCCCGTGTAGG + Intergenic
1054572944 9:66830782-66830804 AAAGCCCGGAGCTCCCGTGTAGG - Intergenic
1055059153 9:72050764-72050786 ACAGGCATGAGCTACCGTGCTGG - Intergenic
1055198279 9:73624752-73624774 ACAGGCATGAGCCACCATGTCGG - Intergenic
1055276690 9:74625335-74625357 ACAGGCATGAGCCACCATGCTGG - Intronic
1055302740 9:74899227-74899249 ACAGGCATGATCTACCACGTGGG - Intergenic
1056215470 9:84402377-84402399 ACAGGCAAGTGCTACCATGCTGG + Intergenic
1056395503 9:86177451-86177473 AGAGCCAGGTGCTGCCTTGTAGG - Intergenic
1056578310 9:87872340-87872362 ACAGGCAGGAGCCTCCATCTGGG - Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1057554703 9:96078418-96078440 ACAGCCATGGGGTGCCATGTCGG - Intergenic
1057737632 9:97679417-97679439 AAAGACAGGAGCTACCTTGAAGG + Intronic
1058137059 9:101318630-101318652 ACAGGCATGCGCTACCATGCCGG - Intronic
1059230151 9:112713414-112713436 ACAGGCATGAGCCACCATGCTGG - Intronic
1060256364 9:122034633-122034655 GATGCCAGGAGCTTCCATGTGGG - Intronic
1060486377 9:124049930-124049952 ACAGGCATGAGCTACCATACCGG + Intergenic
1060653696 9:125352828-125352850 ACAGGCATGAGCTACCATGCTGG - Intronic
1061006705 9:127932229-127932251 ACAGCCGCGTGCTACCATGCTGG + Intergenic
1061022640 9:128026215-128026237 ACAGGCATGAGCTACCGTGCCGG + Intergenic
1061077958 9:128353227-128353249 ACAGCCAGGTGCGGCCAGGTTGG + Exonic
1061224035 9:129270167-129270189 AGAGCCATGAGCCACCATGCTGG + Intergenic
1061567746 9:131454908-131454930 ACAGGCATGAGCCACCATGTTGG + Intronic
1061941410 9:133886142-133886164 ACAGGAAGGAGCACCCATGTGGG + Intronic
1062173929 9:135150519-135150541 GCAGCCTGGACCCACCATGTGGG - Intergenic
1062222621 9:135425762-135425784 ACAGGCATGAGCCACCATGCTGG - Intergenic
1062441434 9:136571454-136571476 ACAGCCAGGAAGGACCAAGTGGG - Intergenic
1062474649 9:136720993-136721015 CCAGCCAGAAGCTGCCATGCAGG + Intronic
1062638743 9:137505968-137505990 ACAGCCAGGGCCTACCTTGCTGG + Exonic
1185496350 X:557193-557215 ACAGGCATGAGCCACCATGCTGG + Intergenic
1185571771 X:1140023-1140045 ACAGGCATGAGCCACCATGCCGG + Intergenic
1185598315 X:1321991-1322013 ACAGGCATGAGCCACCATGCCGG - Intergenic
1185645184 X:1610697-1610719 ACAGTCAGAAGCTGCCATTTTGG - Intergenic
1185840669 X:3387073-3387095 ACAGGCATGAGCCACCACGTCGG + Intergenic
1185919255 X:4071113-4071135 ACAGGCATGAGCCACCATGCCGG - Intergenic
1186160917 X:6776253-6776275 ACAGGCATGAGCCACCATGCTGG - Intergenic
1186800002 X:13083509-13083531 ACAGGCATGAGCCACCATGCTGG - Intergenic
1187176904 X:16904215-16904237 ACAGGCATGTGCCACCATGTTGG - Intergenic
1187188656 X:17012101-17012123 ACAGGCATGAGCCACCATGCCGG - Intronic
1187719132 X:22133295-22133317 ACAGGCATGAGCCACCATGCTGG + Intronic
1187932440 X:24305892-24305914 GCAGGCATGAGCTACCATGCCGG - Intergenic
1187937323 X:24348628-24348650 ACAGGCATGAGCTACCATGCCGG - Intergenic
1189512996 X:41682409-41682431 ACAGGCACGCGCTACCATGCTGG - Intronic
1190100602 X:47520113-47520135 ACAGGCATGAGCCACCATGCCGG - Intergenic
1190238098 X:48632757-48632779 ACAGGCATGAGCCACCATGCTGG + Intergenic
1190715181 X:53096989-53097011 ACAGGCATGTGCCACCATGTGGG - Intergenic
1191959230 X:66681535-66681557 AGAGCCAGGACATACCATTTTGG - Intergenic
1192291839 X:69805580-69805602 CCAGGTAGGAGCTTCCATGTTGG + Intronic
1193018728 X:76766323-76766345 CCAGCCAATTGCTACCATGTAGG + Intergenic
1194521586 X:94925304-94925326 ACAGGCATGAGCCACCATGTTGG - Intergenic
1194711913 X:97245687-97245709 ACAGGCATGAGCCCCCATGTGGG + Intronic
1195252132 X:103059262-103059284 ACAGGCATGAGCCACCATGCAGG + Intergenic
1195365995 X:104126028-104126050 ACAGGCATGAGCCACCATGCTGG - Intronic
1195683450 X:107565415-107565437 ACAGGCATGAGCCACCATGCCGG - Intronic
1195693868 X:107652234-107652256 ACAGGCATGAGCCACCATGGCGG + Intergenic
1195865754 X:109431313-109431335 ACAGCCTGGAGATTCCATTTCGG + Intronic
1196524862 X:116720000-116720022 ACAGGCATGAGCCACCACGTGGG + Intergenic
1196726527 X:118900788-118900810 ACAGGCATGAGCCACCGTGTCGG - Intergenic
1196776658 X:119344173-119344195 ACAGCCAGAAGCTAGACTGTGGG + Intergenic
1197825144 X:130581371-130581393 ACAGGCATGAGCCACCATGCCGG + Intergenic
1198097221 X:133391954-133391976 ACAGGCATGAGCCACCATGCTGG - Intronic
1198767251 X:140091973-140091995 ACAGCAAGGACTTTCCATGTGGG + Intergenic
1199732705 X:150652236-150652258 ACAGGCATGAGCCACCATGCTGG - Intronic
1199766613 X:150946046-150946068 ACAGGCATGAGCCACCATGCCGG - Intergenic
1199963972 X:152802799-152802821 ACAGGCATGAGCTACCGTGCCGG + Intergenic
1200131811 X:153853310-153853332 ACAGGCATGAGCCACCATGCTGG + Intergenic
1200327452 X:155256860-155256882 ACAGGCATGTGCTACCATGCTGG + Intergenic
1200771479 Y:7129447-7129469 ACAGGCATGAGCCACCGTGTTGG + Intergenic