ID: 924395502

View in Genome Browser
Species Human (GRCh38)
Location 1:243615543-243615565
Sequence ATTTTATTCAGGGGGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924395497_924395502 -8 Left 924395497 1:243615528-243615550 CCATGTTTGTAATACATTTTATT 0: 1
1: 0
2: 3
3: 93
4: 864
Right 924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924395502 Original CRISPR ATTTTATTCAGGGGGATGAA AGG Intronic
901279276 1:8020292-8020314 TGTTTATTCAGGGTGATAAATGG + Intronic
904466361 1:30710341-30710363 ATTTTATTCAGGAGGCAGTAGGG + Intergenic
904511431 1:31012368-31012390 ATTTTATTGCTGGGGATGATAGG - Intronic
905450678 1:38054094-38054116 CTTGTAGTCAGGGGGAAGAATGG + Intergenic
907552770 1:55318431-55318453 ATTTTAGTCAAGGAGAGGAAAGG - Intergenic
910053597 1:83005676-83005698 ATTTTATTTTGGGGGAAGACAGG - Intergenic
911199903 1:95033905-95033927 ATTTTAAGCAGGAGAATGAAAGG - Intronic
917365593 1:174228905-174228927 ATTTTAGGTAGGGGCATGAAGGG + Intronic
918479425 1:184961753-184961775 ATTTTGATCAGTGGGATGTAAGG + Intronic
919333773 1:196205993-196206015 ATTTTTTTCACTGGGAAGAAAGG + Intergenic
920102000 1:203522496-203522518 CTTTTATTCAGGTCGGTGAAAGG - Intergenic
920237902 1:204521283-204521305 TTTTCATTCAGTGGGATGATAGG + Intronic
920422380 1:205843910-205843932 ATTTTATACTGGAGGAAGAATGG + Intronic
920547940 1:206834304-206834326 TTTTTATTCAGGTGGATAAGAGG - Intronic
921325244 1:213982443-213982465 CTTTTATTCAGGGTGAGGAGTGG - Intergenic
921741641 1:218691925-218691947 ATTTTCTCCAGGGGAATAAAAGG - Intergenic
924379353 1:243447406-243447428 CTTTTATTTTGGGGGAGGAAGGG + Intronic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
924529061 1:244877996-244878018 TTTTGGTTGAGGGGGATGAAAGG - Intergenic
1067171580 10:43911181-43911203 ATTTTAATCAATGGGTTGAATGG + Intergenic
1067180638 10:43983368-43983390 ATTTTATTCAGGGAAATGGGGGG + Intergenic
1067316339 10:45168009-45168031 ATTAGATGAAGGGGGATGAAAGG + Intergenic
1067482740 10:46614678-46614700 GTTTTATTCAGGAGTATAAATGG - Intergenic
1067612014 10:47726986-47727008 GTTTTATTCAGGAGTATAAATGG + Intergenic
1068157018 10:53213395-53213417 GTTTTATTCAAAGTGATGAAAGG - Intergenic
1068300231 10:55129472-55129494 ATTTTATTAAGAGAGATGAGAGG - Intronic
1068594325 10:58886618-58886640 ATTTAATTCATGGGGCTGAGTGG - Intergenic
1071627432 10:87187230-87187252 GTTTTATTCAGGAGTATAAATGG + Intronic
1072269759 10:93765009-93765031 ATTTTATTCATGAGGAAGAAAGG - Intronic
1072386714 10:94938042-94938064 ATTTTTTTTAGGGGGTTTAATGG + Intergenic
1073300345 10:102467541-102467563 ATTTTCTTCAGGGGGTTCAAGGG + Intronic
1074060195 10:109958373-109958395 GTTTTATTCAGGGAAATAAATGG + Intergenic
1076028206 10:127134731-127134753 ATGTTCTTCAGGGAGAAGAAGGG - Intronic
1077154187 11:1084149-1084171 ATTTGACTCACGGGGAGGAAGGG + Intergenic
1079390057 11:20014385-20014407 ATTTTATTAAGGGTGCTGTAGGG - Intronic
1082040673 11:47682281-47682303 ATGTTAGTCAGGGAGATGAAGGG + Intronic
1082958633 11:58898284-58898306 ATTGGTCTCAGGGGGATGAATGG - Intronic
1085208335 11:74750523-74750545 ATTTTATTCCTGGGGTTGAGGGG + Intronic
1086121956 11:83313674-83313696 ATTTTATTTAGGAGGCTAAAGGG + Intergenic
1089691245 11:120187994-120188016 CTTTTATGGTGGGGGATGAATGG + Intergenic
1093893450 12:24550946-24550968 AATATATTCAGGGGGAGGGAAGG - Intergenic
1094528255 12:31247723-31247745 ATTTTATTTAGGGGGAATGATGG - Intergenic
1095076635 12:37936685-37936707 ATTTAATTCTGTGAGATGAATGG + Intergenic
1095155787 12:38852087-38852109 GTTTTATTAAGGGGGAAGACAGG - Intronic
1095682364 12:44993068-44993090 ATTTTTTCCAGGAAGATGAAAGG + Intergenic
1098848122 12:75562833-75562855 ATTTTAATAAGGAGGTTGAAAGG - Intergenic
1099298401 12:80860567-80860589 AGTTAATTCAGGGTGGTGAATGG + Intronic
1099790185 12:87324125-87324147 ATTTTTTTCAGGAGGAGAAATGG - Intergenic
1100011065 12:89953855-89953877 CTTATTTTCAGTGGGATGAAGGG - Intergenic
1103474507 12:121209068-121209090 ATTGTATTCATGGGGTAGAACGG + Intergenic
1103712357 12:122922225-122922247 ATTTTCTTCAGGGGTAGGAGAGG - Intronic
1107416188 13:40202917-40202939 ATATTAACTAGGGGGATGAATGG + Intergenic
1107721241 13:43250564-43250586 ATTTTCTTTTGGGGGCTGAATGG + Intronic
1108019587 13:46113418-46113440 AGTTTATTCAGAGGTATGTAAGG - Intergenic
1108503272 13:51087061-51087083 GTTTTATTCAGGGGGCTCACTGG - Intergenic
1108536002 13:51379724-51379746 ATGTTTGTCAGTGGGATGAAAGG + Intronic
1108925688 13:55740812-55740834 ATATTATTCAGAGGTATAAAAGG - Intergenic
1108927046 13:55763659-55763681 ATTTTATTCAGTAGTATCAATGG + Intergenic
1109001983 13:56816601-56816623 AGTTCATTCACAGGGATGAAGGG + Intergenic
1110618111 13:77564010-77564032 ATTTTATTCCCAGGGATGGAGGG + Intronic
1110884010 13:80609855-80609877 AATTTTTTCAGGGAGATGCATGG - Intergenic
1111435743 13:88204835-88204857 ATTGTATTCAGGGGTAAGCAAGG + Intergenic
1113196806 13:107817905-107817927 ATCTTTTTCAGGTGGATGGATGG - Intronic
1113520928 13:110940381-110940403 ATTTTATTAAGGTGGGTGTAGGG - Intergenic
1114318475 14:21526965-21526987 CTATTATTCAGGGGGAGGAGGGG - Intronic
1114343741 14:21773080-21773102 ATTTTAAGCAGGGAGATGATAGG - Intergenic
1114370980 14:22087817-22087839 AGTTTATTTAGGGTGATGGATGG + Intergenic
1114701033 14:24678927-24678949 ATTTTGATCAGGGGGATAATAGG - Intergenic
1116290738 14:43035581-43035603 ATATTATTAAGGGGAATGAACGG - Intergenic
1117594003 14:57307773-57307795 CTCTGATTCAGGGGGTTGAATGG - Intergenic
1117871412 14:60204974-60204996 ATGTTATTCTGGAGGCTGAAAGG + Intergenic
1118544454 14:66871294-66871316 ACTTTATTCAGGGACATGAAGGG - Intronic
1119419148 14:74496579-74496601 ATCTTTTTAAGGAGGATGAAAGG - Exonic
1119866721 14:77980741-77980763 AATTTATTCAGGGAGAAGAGGGG - Intergenic
1120468640 14:84894545-84894567 ATTTTAATAAGAGGGAAGAATGG - Intergenic
1120473611 14:84958697-84958719 ATATTTTTCAGGGGGAGGAAGGG + Intergenic
1122157332 14:99757783-99757805 ATTTTATTCAGGGAGCTTCATGG - Intronic
1122331874 14:100923962-100923984 AATTAATTCAAGGGAATGAATGG + Intergenic
1123578438 15:21695394-21695416 AGTTCCCTCAGGGGGATGAAGGG + Intergenic
1123615063 15:22137876-22137898 AGTTCCCTCAGGGGGATGAAGGG + Intergenic
1124575684 15:30906056-30906078 GTTTTATTGAGAGGGATGCATGG + Intronic
1124814651 15:32977400-32977422 ATCTTTTTCAGGAGGATGGAGGG - Intronic
1124830103 15:33140243-33140265 ATTTAATTAAAGGGGATAAACGG - Intronic
1126321643 15:47430487-47430509 TTTTTACTCAGGTAGATGAAAGG + Intronic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1127064699 15:55224759-55224781 ATTTTATTCTGGGGTGTGATGGG - Intronic
1127211422 15:56778591-56778613 AGTTTTTTAAGGGGAATGAATGG + Intronic
1127882606 15:63171367-63171389 ATTATATTCATAAGGATGAAAGG - Intergenic
1129065031 15:72895415-72895437 AGTTTATTCAGAGGTATGTAAGG + Intergenic
1129205259 15:74033522-74033544 ATCTTATTCAGTGGGAATAAGGG - Intronic
1132173586 15:99689128-99689150 ATTTCATTAAGGGAGATGGAAGG + Intronic
1202987308 15_KI270727v1_random:429639-429661 AGTTCCCTCAGGGGGATGAAGGG + Intergenic
1133616002 16:7477495-7477517 ATAATATTCAGGGGGCAGAAGGG - Intronic
1139197949 16:64943116-64943138 ATTTTCTTCAGTGTAATGAAGGG + Intergenic
1139686658 16:68609217-68609239 ATTTTATGCTGGGGGGTGACAGG + Intergenic
1140429126 16:74886385-74886407 ATTTTCTTCAGCGGGAAGAGAGG - Exonic
1141874687 16:86815222-86815244 GTTTTATTCAGTGGAATAAAAGG + Intergenic
1143963730 17:10741279-10741301 TTTTTATTAAAGGGGATGATTGG + Intergenic
1148188294 17:45660552-45660574 ATTTTATTCAGTGTGTTAAATGG + Intergenic
1150147418 17:62780694-62780716 ATTTACTTCATGGGGAAGAAAGG - Intronic
1152212890 17:79012366-79012388 ATTTTATCCAGGGTAATGGATGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155109606 18:22700784-22700806 TTTTTATTAAGGAGGATTAATGG - Intergenic
1155899909 18:31376505-31376527 ATTTTATTCAGCATGATGATAGG + Intergenic
1157319846 18:46625626-46625648 ATTTACTTGAGGGTGATGAATGG - Intronic
1160112706 18:76048570-76048592 ACTTTACAAAGGGGGATGAATGG + Intergenic
1162121008 19:8468561-8468583 ATATTATTGTGGGGGATGATGGG - Intronic
1163890487 19:20008226-20008248 AGTTTATTCATGTGAATGAAGGG - Intronic
1164085509 19:21898715-21898737 ATTTCAATCAGGCGGAAGAAAGG - Intergenic
1165369171 19:35391997-35392019 GTTTTATTCAGGGCAATGACAGG - Intergenic
926339706 2:11894895-11894917 ATCATAGGCAGGGGGATGAAGGG + Intergenic
927381867 2:22488734-22488756 ATTTTTATCAGGAGGTTGAAGGG - Intergenic
928730630 2:34227775-34227797 AATTATTTCAGGGAGATGAAAGG + Intergenic
929117339 2:38455696-38455718 GCTTTATTCAGTGGGTTGAAGGG - Intergenic
929287580 2:40153216-40153238 ATTTTATTTATGAGAATGAAGGG + Intronic
929444103 2:41989281-41989303 ATTTTATTCAGGGTGAGCATCGG - Intergenic
930212985 2:48662520-48662542 AGTTTATTCAAGGGGATCCATGG + Intronic
932392032 2:71401430-71401452 ATCTTATTCAGGAAGATAAAAGG + Intronic
933256986 2:80092481-80092503 ATTTTCTTTAGAGTGATGAAAGG + Intronic
933449561 2:82429873-82429895 ATTTTTTTGAGGGGGAGGAGAGG + Intergenic
934607302 2:95706356-95706378 ATTAAATTCAGTGGGATTAATGG + Intergenic
934792166 2:97070565-97070587 ATTTGATGCAGGGGAAGGAAGGG + Intergenic
934814454 2:97313144-97313166 ATTTGATGCAGGGGAAGGAAGGG - Intergenic
934823239 2:97395339-97395361 ATTTGATGCAGGGGAAGGAAGGG + Intergenic
936540705 2:113348539-113348561 ATTAAATTCAGTGGGATTAATGG + Intergenic
938993445 2:136653292-136653314 ATTCTATTCTGTGTGATGAAGGG + Intergenic
939398073 2:141658142-141658164 AAATTATTGAGGGGGATGAGAGG + Intronic
940773375 2:157861951-157861973 ATTTTACTCAAGAGGATAAAAGG + Intronic
942463036 2:176182521-176182543 ATTTTAGTCAGGGTGAGTAATGG - Intergenic
944736408 2:202570787-202570809 AGTTTTTTCAGGGGGATGAGAGG + Intergenic
944898427 2:204189362-204189384 ATTTTATTCAAGAAGATAAAAGG + Intergenic
945697347 2:213124180-213124202 ATTATTTTCAGTGAGATGAATGG + Intronic
948117943 2:235507533-235507555 ATTTTATTCAGTGAGGGGAAGGG - Intronic
1170452345 20:16496945-16496967 ATTTTGTTCATGGTGCTGAATGG - Intronic
1171293868 20:23999506-23999528 GTTTTATTTAGAAGGATGAAGGG + Intergenic
1172304926 20:33873953-33873975 ATTTTATTCCGAGGAATTAATGG - Intergenic
1172945213 20:38682261-38682283 TTTTATTTCAGGGGGAGGAAGGG + Intergenic
1173135386 20:40434406-40434428 ATTCTATGCAGTGGGTTGAATGG + Intergenic
1175665058 20:60851706-60851728 ATTTTCATCAGGTGGAGGAAGGG + Intergenic
1177462337 21:21429397-21429419 AGTATATTCTGGGGGATGAGAGG - Intronic
1177648662 21:23933105-23933127 AATTCATTCAGGCGGATAAATGG - Intergenic
1178221267 21:30662697-30662719 ATTTTTTTCCGGGGGGTGGAGGG - Intergenic
1180786659 22:18551408-18551430 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1180976280 22:19850614-19850636 CTTTGATTCTGGGGGATGAGTGG - Exonic
1181131950 22:20737221-20737243 CCTTTATTCTGGAGGATGAAAGG + Intronic
1181243574 22:21490929-21490951 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1181687615 22:24540518-24540540 ATTCTAGCCACGGGGATGAAAGG - Intronic
1182237600 22:28888472-28888494 ATTTGATTCAGGGGGAAAACTGG + Intronic
1183326107 22:37195345-37195367 ATTTTATTCTGGGTAATGTATGG - Intronic
1184558983 22:45250564-45250586 AGTTAATTTAGGGGGATTAAAGG - Intergenic
1184789557 22:46691462-46691484 ATTTAATTCAAGGGAAGGAAGGG - Intronic
949096608 3:93980-94002 ATTTCATTCAGGGAATTGAACGG - Intergenic
949339294 3:3011226-3011248 ACTTTATTGAGGGACATGAAAGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
951084795 3:18499183-18499205 CTTTGAATCATGGGGATGAATGG + Intergenic
952318516 3:32253895-32253917 ATTTTTTTCAGGGGGGAGGATGG + Intronic
952499971 3:33951995-33952017 ATTTCACTCGAGGGGATGAATGG + Intergenic
952666417 3:35909925-35909947 ATTTTCCTCATGGAGATGAATGG + Intergenic
952815420 3:37443034-37443056 ATTTTATTCAAAGACATGAAGGG - Intergenic
953847266 3:46437659-46437681 ATTTTATTCAGTAAAATGAAAGG - Intronic
954908832 3:54086419-54086441 ATTTTCTTCAGGGGGAAGACTGG + Intergenic
954993638 3:54862355-54862377 ATTTTATTTAGGGAGATGCTTGG - Intronic
955159734 3:56452955-56452977 ATTTTACTCATGAGGAAGAAAGG - Intronic
955298905 3:57758011-57758033 ATTTGATTGAGGTGGTTGAATGG + Intronic
955736630 3:62045679-62045701 ATTTTATTCAAGGTAATGACTGG - Intronic
957017748 3:75089228-75089250 ATTTCACTGAGGGGGAAGAAAGG - Intergenic
957407780 3:79793841-79793863 GTTTTATCCAGGAGTATGAAAGG + Intergenic
957517095 3:81269305-81269327 ATTTTCTTCTGGCAGATGAATGG - Intergenic
957884235 3:86263432-86263454 ACTTTATACAGGTAGATGAAAGG - Intergenic
961716316 3:128859801-128859823 CTTTTATTCAGGCGACTGAAGGG + Intergenic
962102055 3:132352926-132352948 TTTATATTCAGAGGGAAGAATGG + Intronic
963243832 3:143040126-143040148 ATTTAATTTAGGGGGAAGGAAGG + Intronic
964414902 3:156437171-156437193 CTTTTATTCAGGGGGATTAGTGG + Intronic
964978831 3:162653010-162653032 ACTTTATTCAAGGATATGAAAGG + Intergenic
965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG + Intergenic
966324979 3:178743805-178743827 ATTTGATGCAGGAGGATCAAGGG + Intronic
969390489 4:6888742-6888764 ATTCTATTCAGGGAAATGAGCGG - Intergenic
969986405 4:11215819-11215841 ATTTTATTCAAAGAGCTGAAAGG + Intergenic
970858613 4:20676537-20676559 ATTTTATGCAGGAGGCTGCAAGG + Intergenic
972734147 4:41823873-41823895 ATTTTTGTCAGGGAGAAGAAAGG + Intergenic
973713082 4:53648794-53648816 AATGTGTTCAGGGGGATGGAAGG - Intronic
974118109 4:57605860-57605882 ATTTTTCTCAGGGGCTTGAATGG - Intergenic
974681256 4:65165812-65165834 ATTTTATTCAGGGGAATGAGAGG + Intergenic
974965113 4:68750836-68750858 ATTGAATGAAGGGGGATGAATGG + Intergenic
975655496 4:76637444-76637466 ATTATATTCAGGGAAAAGAAAGG + Intronic
976220406 4:82752785-82752807 AGTTTATTTAGGGGGAAAAAGGG - Intronic
977952613 4:102990984-102991006 TTTTTATTAAGGTGGGTGAAAGG + Intronic
978552825 4:109946253-109946275 ATTTTATGTAGGGGAGTGAATGG - Intronic
981189450 4:141843783-141843805 AATATATTCAAGTGGATGAAAGG + Intergenic
981815072 4:148821345-148821367 AATTCATTCTGGGGTATGAATGG - Intergenic
983823843 4:172231862-172231884 AGTTTATTCAGGAGGTGGAAAGG - Intronic
984537398 4:180993939-180993961 GTTTTGTTCAGTGGGATCAAGGG - Intergenic
985262648 4:188129064-188129086 ATTTTTTGCAGGGGGGTGAGAGG + Intergenic
987396007 5:17424257-17424279 ATTTTATTCATGGCTGTGAATGG + Intergenic
987418767 5:17693110-17693132 ATTTTAAGCAGAGGGATGACTGG + Intergenic
987592808 5:19953485-19953507 ATTTTATTCATGGGCATTATTGG + Intronic
988453607 5:31367624-31367646 ATTTAATTATGGGAGATGAAAGG - Intergenic
990008805 5:50970832-50970854 ATTTTAATCAGGGCAATAAAAGG - Intergenic
992040746 5:72828338-72828360 ATTTAGTTGTGGGGGATGAACGG + Intronic
992575694 5:78108769-78108791 GTTTTTTTCAGGGGGAGGAAGGG + Intronic
993171831 5:84429903-84429925 ATTTTATTCACTGGGTTGAACGG + Intergenic
994222779 5:97215629-97215651 ATTCTATTCATGTGGATGTAAGG - Intergenic
994289192 5:98008000-98008022 AATTTCTTCATGGTGATGAAAGG - Intergenic
995814925 5:116157443-116157465 ATTTTAATCAGTGGGATGAGTGG + Intronic
996753904 5:126916374-126916396 ATAGTGTTCAGGAGGATGAATGG - Intronic
998727776 5:145037706-145037728 TTTTTTTTCCGGGGGATGGAGGG + Intergenic
998838818 5:146231415-146231437 ATTTTGTTAAAAGGGATGAATGG + Intronic
998890163 5:146737681-146737703 AATTTTTTCACTGGGATGAAAGG - Intronic
999591165 5:153148235-153148257 ATTATATACAGGGGTATGAGGGG - Intergenic
1000502794 5:162073113-162073135 GATTTATTCAGTGGGCTGAATGG - Intronic
1004420244 6:15463194-15463216 ATTTTTTTCAGGGGGAGCAGGGG - Intronic
1005114696 6:22322681-22322703 ATTTTACTCAGAGGGGTCAAAGG - Intergenic
1006881116 6:37340935-37340957 ATTTTATTCAGGAGGAAGAGGGG - Intergenic
1007150225 6:39683162-39683184 ACTTTAAACAGGGGGATGATTGG + Intronic
1008148502 6:47921627-47921649 ATTTTAAGGAGGGGGATAAAAGG - Intronic
1009196011 6:60685235-60685257 ATTTTATTCAAGGACATGAAAGG + Intergenic
1010101367 6:72112150-72112172 ATTGGATGCAGGGGGAGGAAAGG - Intronic
1011791675 6:90905847-90905869 AGTTTATTCAGAGGGATAATAGG - Intergenic
1012568594 6:100694118-100694140 ATATTATTCAGGAAAATGAAAGG - Intronic
1014695457 6:124615191-124615213 ATTTTATAAAGGGGGATATATGG - Intronic
1015308503 6:131737116-131737138 TTTATATTCACAGGGATGAAAGG + Intronic
1015890720 6:137967492-137967514 ATTTTAATCAGGGGGATGATAGG - Intergenic
1016446723 6:144140610-144140632 ATTTTCTTCAGGGTCATGGAAGG + Intergenic
1016619086 6:146086880-146086902 ATGTTATTCAGGGAGATAAATGG + Intronic
1017067177 6:150539834-150539856 ATTTTGCACAGGGAGATGAATGG + Intergenic
1019223692 6:170494155-170494177 ATTTCAAGCAGGGGGATGAGTGG - Intergenic
1020450304 7:8314526-8314548 ATTTTATTCACTGGGTTAAATGG + Intergenic
1020968746 7:14906320-14906342 AATTTATTAAGAGTGATGAAAGG - Intronic
1020982155 7:15084466-15084488 ATTTCATTTAGGGGGAGAAAGGG - Intergenic
1023091127 7:36618565-36618587 ATTTCATTCAGGGAGATGCTGGG + Intronic
1023140944 7:37101740-37101762 ATTCTCTTAAGGGGGATAAAGGG + Intronic
1023406487 7:39838818-39838840 ATTTTATTAACGGGAATAAAAGG - Intergenic
1024689055 7:51779933-51779955 ATTTTACTTAGGGGGATTGAAGG + Intergenic
1025530404 7:61874045-61874067 ATTTAACTCAGCGTGATGAATGG + Intergenic
1027824149 7:83089415-83089437 ATTTTGGTCAGGGGGGAGAAAGG - Intronic
1029032939 7:97488074-97488096 ATCTTCTTCAAGGGTATGAATGG + Intergenic
1035112616 7:156495891-156495913 ATTCTCTTCACGGGGATGGAGGG + Intergenic
1035834294 8:2731759-2731781 ATTTTCTTCAGTGTGATCAAGGG + Intergenic
1037019372 8:13950068-13950090 ATTTTTTTGGGGGGGATTAAAGG + Intergenic
1038075294 8:24066520-24066542 ATTTTACCCAGGGGGAAGGAAGG - Intergenic
1038884999 8:31653435-31653457 ATTTTATTCAGGGGAAAGTCAGG - Intronic
1039877432 8:41598980-41599002 CTTCTATTCAGGCGGTTGAAGGG + Exonic
1039958944 8:42229966-42229988 GTTTTATTCAAGAGAATGAAGGG + Intergenic
1042998021 8:74722178-74722200 ATTTTTTTGAGGGGGTGGAAGGG - Intronic
1044488684 8:92785782-92785804 AGTTTATTCAGGGTAATAAACGG + Intergenic
1044626652 8:94240748-94240770 GTTTTTTTCAGGGGAATAAATGG - Intergenic
1046816487 8:118589910-118589932 ACTTTACTAAGTGGGATGAATGG - Intronic
1046899268 8:119506316-119506338 GTTTTTCTCAGGGGGAGGAAAGG + Intergenic
1047042922 8:121018433-121018455 ATTTTTTTCAGTGCGTTGAAAGG - Intergenic
1048066317 8:130972771-130972793 ATTTTATTCTGGAGTATGACAGG + Intronic
1048644883 8:136409012-136409034 ATTTTATTCCATTGGATGAATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050770784 9:9197114-9197136 ATCTTATTCAGAAGGAAGAAAGG - Intronic
1050948748 9:11561187-11561209 AAATTATTCAGGAGGAAGAAAGG - Intergenic
1052259425 9:26495049-26495071 TTTTTATTTAGGTGCATGAATGG - Intergenic
1053242876 9:36510729-36510751 AATTTATTCTGAGGGATAAAAGG + Intergenic
1054983417 9:71233844-71233866 ATTTTATTCAGTCTGATTAAAGG - Intronic
1057893523 9:98887944-98887966 ATATTATTCAGGGGGAAAAATGG - Intergenic
1058063250 9:100521871-100521893 ATATCACTCAGGGGGATAAATGG - Intronic
1058322246 9:103647571-103647593 ATTTTATTCTAGGGGATAGAGGG + Intergenic
1059245215 9:112843956-112843978 GTTTTATGCAGGGGGATGACAGG + Intronic
1060298551 9:122360135-122360157 ATTTTTTTAAGGAGAATGAAGGG + Intergenic
1185843909 X:3419141-3419163 ATTTTTTTCGGGGAGATAAAGGG - Intergenic
1188290309 X:28379642-28379664 ATTTTTTTCAGGGAGATAATGGG - Intergenic
1189783864 X:44542430-44542452 ATTTTCATCAGTGGGAGGAATGG + Intronic
1190104486 X:47549567-47549589 ATGTTATCCAGGGGCATGGAAGG - Intergenic
1192522219 X:71812930-71812952 CGTTTATTCAGGGAGGTGAAAGG - Intergenic
1192522323 X:71813891-71813913 CGTTTATTCAGGGAGGTGAAAGG + Intergenic
1194922553 X:99784469-99784491 ATTTTATTCAGAGGGTAGAGGGG + Intergenic
1195632983 X:107079134-107079156 TTTTTATTCTGTGAGATGAAAGG - Intronic
1197484417 X:127030092-127030114 ATTTTTTTGAGGGGGATTAAGGG - Intergenic
1198688242 X:139250720-139250742 ATTTGATTCAGAGAAATGAAAGG - Intergenic