ID: 924401310

View in Genome Browser
Species Human (GRCh38)
Location 1:243685344-243685366
Sequence TAATTTGTGCATAAAGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21024
Summary {0: 1, 1: 9, 2: 679, 3: 9770, 4: 10565}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924401310 Original CRISPR TAATTTGTGCATAAAGTGTA AGG Intronic
Too many off-targets to display for this crispr