ID: 924417175

View in Genome Browser
Species Human (GRCh38)
Location 1:243868908-243868930
Sequence CTTCCATCACTCTAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924417175_924417181 12 Left 924417175 1:243868908-243868930 CCCTCTTCCTAGAGTGATGGAAG No data
Right 924417181 1:243868943-243868965 ACAACAAAAAAATTCTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924417175 Original CRISPR CTTCCATCACTCTAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr