ID: 924417181

View in Genome Browser
Species Human (GRCh38)
Location 1:243868943-243868965
Sequence ACAACAAAAAAATTCTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924417173_924417181 18 Left 924417173 1:243868902-243868924 CCTTTACCCTCTTCCTAGAGTGA No data
Right 924417181 1:243868943-243868965 ACAACAAAAAAATTCTTTTTTGG No data
924417175_924417181 12 Left 924417175 1:243868908-243868930 CCCTCTTCCTAGAGTGATGGAAG No data
Right 924417181 1:243868943-243868965 ACAACAAAAAAATTCTTTTTTGG No data
924417179_924417181 5 Left 924417179 1:243868915-243868937 CCTAGAGTGATGGAAGGGATAAA No data
Right 924417181 1:243868943-243868965 ACAACAAAAAAATTCTTTTTTGG No data
924417176_924417181 11 Left 924417176 1:243868909-243868931 CCTCTTCCTAGAGTGATGGAAGG No data
Right 924417181 1:243868943-243868965 ACAACAAAAAAATTCTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924417181 Original CRISPR ACAACAAAAAAATTCTTTTT TGG Intergenic
No off target data available for this crispr