ID: 924418260

View in Genome Browser
Species Human (GRCh38)
Location 1:243882563-243882585
Sequence CCGTATGTACAGTGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924418260_924418266 19 Left 924418260 1:243882563-243882585 CCCTGCTGACACTGTACATACGG No data
Right 924418266 1:243882605-243882627 GTGAAGCTGCTAACCCTATAAGG No data
924418260_924418263 -5 Left 924418260 1:243882563-243882585 CCCTGCTGACACTGTACATACGG No data
Right 924418263 1:243882581-243882603 TACGGCTCACACCCAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924418260 Original CRISPR CCGTATGTACAGTGTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr