ID: 924418263

View in Genome Browser
Species Human (GRCh38)
Location 1:243882581-243882603
Sequence TACGGCTCACACCCAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924418262_924418263 -6 Left 924418262 1:243882564-243882586 CCTGCTGACACTGTACATACGGC No data
Right 924418263 1:243882581-243882603 TACGGCTCACACCCAGAGAGAGG No data
924418259_924418263 23 Left 924418259 1:243882535-243882557 CCACTGTTGTCTGTAAAAGGTAT 0: 13
1: 107
2: 106
3: 78
4: 177
Right 924418263 1:243882581-243882603 TACGGCTCACACCCAGAGAGAGG No data
924418260_924418263 -5 Left 924418260 1:243882563-243882585 CCCTGCTGACACTGTACATACGG No data
Right 924418263 1:243882581-243882603 TACGGCTCACACCCAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924418263 Original CRISPR TACGGCTCACACCCAGAGAG AGG Intergenic
No off target data available for this crispr