ID: 924418266

View in Genome Browser
Species Human (GRCh38)
Location 1:243882605-243882627
Sequence GTGAAGCTGCTAACCCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924418264_924418266 -10 Left 924418264 1:243882592-243882614 CCCAGAGAGAGGAGTGAAGCTGC No data
Right 924418266 1:243882605-243882627 GTGAAGCTGCTAACCCTATAAGG No data
924418260_924418266 19 Left 924418260 1:243882563-243882585 CCCTGCTGACACTGTACATACGG No data
Right 924418266 1:243882605-243882627 GTGAAGCTGCTAACCCTATAAGG No data
924418262_924418266 18 Left 924418262 1:243882564-243882586 CCTGCTGACACTGTACATACGGC No data
Right 924418266 1:243882605-243882627 GTGAAGCTGCTAACCCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924418266 Original CRISPR GTGAAGCTGCTAACCCTATA AGG Intergenic
No off target data available for this crispr