ID: 924419188

View in Genome Browser
Species Human (GRCh38)
Location 1:243891646-243891668
Sequence GTAGCCAGTACAGAGTAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924419188_924419192 4 Left 924419188 1:243891646-243891668 CCGCCTTACTCTGTACTGGCTAC No data
Right 924419192 1:243891673-243891695 TCAGGAAGGTCTCCCCATAATGG No data
924419188_924419196 21 Left 924419188 1:243891646-243891668 CCGCCTTACTCTGTACTGGCTAC No data
Right 924419196 1:243891690-243891712 TAATGGTTTCTAGCAGTTACAGG No data
924419188_924419191 -10 Left 924419188 1:243891646-243891668 CCGCCTTACTCTGTACTGGCTAC No data
Right 924419191 1:243891659-243891681 TACTGGCTACATTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924419188 Original CRISPR GTAGCCAGTACAGAGTAAGG CGG (reversed) Intergenic
No off target data available for this crispr