ID: 924419191

View in Genome Browser
Species Human (GRCh38)
Location 1:243891659-243891681
Sequence TACTGGCTACATTCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924419186_924419191 3 Left 924419186 1:243891633-243891655 CCATCTTTCAGCTCCGCCTTACT No data
Right 924419191 1:243891659-243891681 TACTGGCTACATTCTCAGGAAGG No data
924419188_924419191 -10 Left 924419188 1:243891646-243891668 CCGCCTTACTCTGTACTGGCTAC No data
Right 924419191 1:243891659-243891681 TACTGGCTACATTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924419191 Original CRISPR TACTGGCTACATTCTCAGGA AGG Intergenic