ID: 924419196 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:243891690-243891712 |
Sequence | TAATGGTTTCTAGCAGTTAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
924419189_924419196 | 18 | Left | 924419189 | 1:243891649-243891671 | CCTTACTCTGTACTGGCTACATT | No data | ||
Right | 924419196 | 1:243891690-243891712 | TAATGGTTTCTAGCAGTTACAGG | No data | ||||
924419188_924419196 | 21 | Left | 924419188 | 1:243891646-243891668 | CCGCCTTACTCTGTACTGGCTAC | No data | ||
Right | 924419196 | 1:243891690-243891712 | TAATGGTTTCTAGCAGTTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
924419196 | Original CRISPR | TAATGGTTTCTAGCAGTTAC AGG | Intergenic | ||