ID: 924419196

View in Genome Browser
Species Human (GRCh38)
Location 1:243891690-243891712
Sequence TAATGGTTTCTAGCAGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924419189_924419196 18 Left 924419189 1:243891649-243891671 CCTTACTCTGTACTGGCTACATT No data
Right 924419196 1:243891690-243891712 TAATGGTTTCTAGCAGTTACAGG No data
924419188_924419196 21 Left 924419188 1:243891646-243891668 CCGCCTTACTCTGTACTGGCTAC No data
Right 924419196 1:243891690-243891712 TAATGGTTTCTAGCAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924419196 Original CRISPR TAATGGTTTCTAGCAGTTAC AGG Intergenic