ID: 924421777

View in Genome Browser
Species Human (GRCh38)
Location 1:243916811-243916833
Sequence CATCTATGTTTCCATCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924421777_924421784 11 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421784 1:243916845-243916867 GGGTGGCAGTGCAGGTAACAGGG No data
924421777_924421782 3 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421782 1:243916837-243916859 TTACGGCAGGGTGGCAGTGCAGG No data
924421777_924421779 -10 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421779 1:243916824-243916846 AACATAGATGTGTTTACGGCAGG No data
924421777_924421786 26 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421786 1:243916860-243916882 TAACAGGGAAGTCCTTGCTAGGG No data
924421777_924421783 10 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421783 1:243916844-243916866 AGGGTGGCAGTGCAGGTAACAGG No data
924421777_924421785 25 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421785 1:243916859-243916881 GTAACAGGGAAGTCCTTGCTAGG No data
924421777_924421780 -9 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421780 1:243916825-243916847 ACATAGATGTGTTTACGGCAGGG No data
924421777_924421781 -6 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421781 1:243916828-243916850 TAGATGTGTTTACGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924421777 Original CRISPR CATCTATGTTTCCATCTCAG CGG (reversed) Intergenic
No off target data available for this crispr