ID: 924421782

View in Genome Browser
Species Human (GRCh38)
Location 1:243916837-243916859
Sequence TTACGGCAGGGTGGCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924421777_924421782 3 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421782 1:243916837-243916859 TTACGGCAGGGTGGCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924421782 Original CRISPR TTACGGCAGGGTGGCAGTGC AGG Intergenic
No off target data available for this crispr