ID: 924421785

View in Genome Browser
Species Human (GRCh38)
Location 1:243916859-243916881
Sequence GTAACAGGGAAGTCCTTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924421777_924421785 25 Left 924421777 1:243916811-243916833 CCGCTGAGATGGAAACATAGATG No data
Right 924421785 1:243916859-243916881 GTAACAGGGAAGTCCTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924421785 Original CRISPR GTAACAGGGAAGTCCTTGCT AGG Intergenic
No off target data available for this crispr