ID: 924421974

View in Genome Browser
Species Human (GRCh38)
Location 1:243918158-243918180
Sequence CTTCTGTGAGCTCTGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924421974_924421982 7 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421982 1:243918188-243918210 ATCCCCGTGGGGCCGCAGGGAGG No data
924421974_924421977 -6 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421977 1:243918175-243918197 CAGAAGAAGGGCTATCCCCGTGG No data
924421974_924421987 21 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421987 1:243918202-243918224 GCAGGGAGGTGATCTGCTCCTGG No data
924421974_924421979 -4 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421979 1:243918177-243918199 GAAGAAGGGCTATCCCCGTGGGG No data
924421974_924421978 -5 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421978 1:243918176-243918198 AGAAGAAGGGCTATCCCCGTGGG No data
924421974_924421981 4 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421981 1:243918185-243918207 GCTATCCCCGTGGGGCCGCAGGG No data
924421974_924421980 3 Left 924421974 1:243918158-243918180 CCTGAAGTCAGAGCTCACAGAAG No data
Right 924421980 1:243918184-243918206 GGCTATCCCCGTGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924421974 Original CRISPR CTTCTGTGAGCTCTGACTTC AGG (reversed) Intergenic
No off target data available for this crispr