ID: 924422815

View in Genome Browser
Species Human (GRCh38)
Location 1:243925112-243925134
Sequence CAGCCAAGGCTGGCCTTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924422815_924422825 25 Left 924422815 1:243925112-243925134 CCCGGCAAGGCCAGCCTTGGCTG No data
Right 924422825 1:243925160-243925182 TTCGCAGAGAACAATAACCTGGG No data
924422815_924422824 24 Left 924422815 1:243925112-243925134 CCCGGCAAGGCCAGCCTTGGCTG No data
Right 924422824 1:243925159-243925181 CTTCGCAGAGAACAATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924422815 Original CRISPR CAGCCAAGGCTGGCCTTGCC GGG (reversed) Intergenic
No off target data available for this crispr