ID: 924422940

View in Genome Browser
Species Human (GRCh38)
Location 1:243926094-243926116
Sequence CTGAGATAGACGTCGGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924422930_924422940 26 Left 924422930 1:243926045-243926067 CCATGGGATGGAAGCGTTTTGGA No data
Right 924422940 1:243926094-243926116 CTGAGATAGACGTCGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924422940 Original CRISPR CTGAGATAGACGTCGGGATA GGG Intergenic
No off target data available for this crispr