ID: 924423424

View in Genome Browser
Species Human (GRCh38)
Location 1:243930523-243930545
Sequence CAAGATTCAAAGGTGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924423424_924423430 17 Left 924423424 1:243930523-243930545 CCAACCTCCACCTTTGAATCTTG No data
Right 924423430 1:243930563-243930585 AGGGCCTCGCTCTGTTGTCCAGG 0: 8
1: 143
2: 2654
3: 22887
4: 84055
924423424_924423428 -3 Left 924423424 1:243930523-243930545 CCAACCTCCACCTTTGAATCTTG No data
Right 924423428 1:243930543-243930565 TTGCTTGCTTGCTTGCTTACAGG No data
924423424_924423429 -2 Left 924423424 1:243930523-243930545 CCAACCTCCACCTTTGAATCTTG No data
Right 924423429 1:243930544-243930566 TGCTTGCTTGCTTGCTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924423424 Original CRISPR CAAGATTCAAAGGTGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr