ID: 924424259

View in Genome Browser
Species Human (GRCh38)
Location 1:243936198-243936220
Sequence CCATGAGCACATAAGGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924424259_924424263 -2 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424263 1:243936219-243936241 GGACATCTCTTCTAGGTCATTGG No data
924424259_924424262 -9 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424262 1:243936212-243936234 TGCTCATGGACATCTCTTCTAGG No data
924424259_924424264 -1 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424264 1:243936220-243936242 GACATCTCTTCTAGGTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924424259 Original CRISPR CCATGAGCACATAAGGTATG TGG (reversed) Intergenic
No off target data available for this crispr