ID: 924424262

View in Genome Browser
Species Human (GRCh38)
Location 1:243936212-243936234
Sequence TGCTCATGGACATCTCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924424259_924424262 -9 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424262 1:243936212-243936234 TGCTCATGGACATCTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924424262 Original CRISPR TGCTCATGGACATCTCTTCT AGG Intergenic
No off target data available for this crispr