ID: 924424263

View in Genome Browser
Species Human (GRCh38)
Location 1:243936219-243936241
Sequence GGACATCTCTTCTAGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924424259_924424263 -2 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424263 1:243936219-243936241 GGACATCTCTTCTAGGTCATTGG No data
924424261_924424263 -9 Left 924424261 1:243936205-243936227 CCTTATGTGCTCATGGACATCTC No data
Right 924424263 1:243936219-243936241 GGACATCTCTTCTAGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924424263 Original CRISPR GGACATCTCTTCTAGGTCAT TGG Intergenic
No off target data available for this crispr