ID: 924424264

View in Genome Browser
Species Human (GRCh38)
Location 1:243936220-243936242
Sequence GACATCTCTTCTAGGTCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924424261_924424264 -8 Left 924424261 1:243936205-243936227 CCTTATGTGCTCATGGACATCTC No data
Right 924424264 1:243936220-243936242 GACATCTCTTCTAGGTCATTGGG No data
924424259_924424264 -1 Left 924424259 1:243936198-243936220 CCACATACCTTATGTGCTCATGG No data
Right 924424264 1:243936220-243936242 GACATCTCTTCTAGGTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924424264 Original CRISPR GACATCTCTTCTAGGTCATT GGG Intergenic
No off target data available for this crispr