ID: 924434583

View in Genome Browser
Species Human (GRCh38)
Location 1:244027804-244027826
Sequence CCACCTAAGGGAAAGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924434575_924434583 4 Left 924434575 1:244027777-244027799 CCATCAGACAGAATTAGTCACAA No data
Right 924434583 1:244027804-244027826 CCACCTAAGGGAAAGTGGGGTGG No data
924434573_924434583 29 Left 924434573 1:244027752-244027774 CCTGTAGGATTCACAGGTCCACA No data
Right 924434583 1:244027804-244027826 CCACCTAAGGGAAAGTGGGGTGG No data
924434574_924434583 11 Left 924434574 1:244027770-244027792 CCACAGTCCATCAGACAGAATTA No data
Right 924434583 1:244027804-244027826 CCACCTAAGGGAAAGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924434583 Original CRISPR CCACCTAAGGGAAAGTGGGG TGG Intergenic
No off target data available for this crispr