ID: 924436732

View in Genome Browser
Species Human (GRCh38)
Location 1:244049044-244049066
Sequence CCCGGCACCCCGGCGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1382
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 1316}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924436717_924436732 -4 Left 924436717 1:244049025-244049047 CCTGGCGCCCCCTCCGCGCCCCG 0: 1
1: 0
2: 24
3: 121
4: 953
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436714_924436732 3 Left 924436714 1:244049018-244049040 CCCCTGACCTGGCGCCCCCTCCG 0: 1
1: 0
2: 2
3: 106
4: 477
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436709_924436732 14 Left 924436709 1:244049007-244049029 CCGGCCCCTGGCCCCTGACCTGG 0: 1
1: 0
2: 12
3: 131
4: 1005
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436716_924436732 1 Left 924436716 1:244049020-244049042 CCTGACCTGGCGCCCCCTCCGCG No data
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436713_924436732 8 Left 924436713 1:244049013-244049035 CCTGGCCCCTGACCTGGCGCCCC 0: 1
1: 0
2: 1
3: 48
4: 520
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436715_924436732 2 Left 924436715 1:244049019-244049041 CCCTGACCTGGCGCCCCCTCCGC 0: 1
1: 0
2: 2
3: 23
4: 226
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436707_924436732 21 Left 924436707 1:244049000-244049022 CCCGGCGCCGGCCCCTGGCCCCT 0: 1
1: 0
2: 6
3: 101
4: 652
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436712_924436732 9 Left 924436712 1:244049012-244049034 CCCTGGCCCCTGACCTGGCGCCC 0: 1
1: 0
2: 2
3: 34
4: 414
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436711_924436732 10 Left 924436711 1:244049011-244049033 CCCCTGGCCCCTGACCTGGCGCC 0: 1
1: 0
2: 3
3: 24
4: 392
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316
924436708_924436732 20 Left 924436708 1:244049001-244049023 CCGGCGCCGGCCCCTGGCCCCTG 0: 1
1: 0
2: 5
3: 111
4: 811
Right 924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG 0: 1
1: 0
2: 4
3: 61
4: 1316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924436732 Original CRISPR CCCGGCACCCCGGCGGGCGG GGG Intronic
900161833 1:1227580-1227602 CCCGGCACCCTGGCTGGCCTGGG + Intronic
900204951 1:1427733-1427755 CGGGGCGCCCCGGGGGGCGGCGG - Exonic
900516919 1:3086537-3086559 CAAGGCAGCCCGGCGGGAGGAGG - Intronic
900599635 1:3497511-3497533 CCCGCCACCCCGGAGGGCAGAGG + Intronic
900983791 1:6061351-6061373 CCCAGCACCGGGCCGGGCGGGGG + Intronic
901028968 1:6295094-6295116 CCCTGCACCCCTGCTGGCTGCGG - Intronic
901030845 1:6305934-6305956 CCCGGCACCTCGGGAGGCCGAGG + Intronic
901224082 1:7601686-7601708 CCCGGCACCTCGGGAGGCCGAGG + Intronic
901270855 1:7952319-7952341 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
901343150 1:8513526-8513548 CCCGGCACTCTGGGGGGCCGAGG + Intronic
901849995 1:12008945-12008967 CCCGGCACCTCGGGAGGCCGAGG + Intronic
901855683 1:12042924-12042946 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
901970265 1:12902644-12902666 CCCGGCACCTCGGGAGGCCGAGG - Intronic
902014900 1:13299125-13299147 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
902018534 1:13327888-13327910 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
902062483 1:13657639-13657661 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
902142094 1:14365352-14365374 CCCCCCACCCCGGGGGGAGGGGG - Intergenic
903081231 1:20815033-20815055 CCCGGCACCTCGGGAGGCCGAGG - Intronic
903100235 1:21023508-21023530 CCCGGCACCTCGGGAGGCCGAGG - Intronic
903103285 1:21052831-21052853 CCCGGCACCTCGGGAGGCCGAGG - Intronic
903163092 1:21503202-21503224 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
903441809 1:23393933-23393955 CCAGGAACCCCGGCCTGCGGCGG - Exonic
903485723 1:23688438-23688460 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
903531330 1:24032623-24032645 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
903610019 1:24604322-24604344 CCCGGCACCCCAGGAGGCTGAGG + Intronic
903628222 1:24745974-24745996 CCCGGCGCCCGGGCGGGGGGTGG - Intronic
903633799 1:24798895-24798917 CCCGGCACCTCGGGAGGCCGAGG - Intronic
903638102 1:24834566-24834588 CCCGGCACCTCGGGAGGCCGAGG + Intronic
903748331 1:25603510-25603532 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
903813245 1:26046320-26046342 CCCGGCGCCGCGCCGGGCGAAGG - Intergenic
903819136 1:26087778-26087800 CCCTTGACCCCGGGGGGCGGAGG + Intergenic
903921748 1:26804600-26804622 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
903961985 1:27063663-27063685 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
903993461 1:27289730-27289752 CCCGGCACCTCGGGAGGCCGAGG + Intronic
904000684 1:27336725-27336747 CTCTGTACCCCGGCGGGTGGTGG - Intergenic
904077216 1:27852387-27852409 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
904531956 1:31176060-31176082 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
904784901 1:32975585-32975607 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
904831770 1:33310049-33310071 CCCGGCACCTCGGGAGGCCGAGG + Intronic
904857447 1:33509892-33509914 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
905039910 1:34947677-34947699 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
905066973 1:35192472-35192494 CCCGGGACTGCCGCGGGCGGAGG + Exonic
905137036 1:35808081-35808103 CCCAGGGTCCCGGCGGGCGGAGG - Intergenic
905315475 1:37080029-37080051 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
905526951 1:38647059-38647081 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
905680750 1:39869353-39869375 CCCGGCACCTCGGGAGGCCGAGG - Intronic
905686747 1:39913761-39913783 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
905742739 1:40387101-40387123 CCTGGCACTCCGGCAGGCCGAGG - Intronic
906329845 1:44876034-44876056 CCCGGCACCTCGGGAGGCCGAGG - Intronic
906353269 1:45081561-45081583 CCCGGCACCTCGGGAGGCCGAGG - Intronic
906427075 1:45724232-45724254 CCCGGCACCTCGGGAGGCGAAGG - Intronic
906762037 1:48384081-48384103 CCCGGCACCTCGGGAGGCCGAGG + Intronic
906956705 1:50381263-50381285 CCCGGCACCTCGGGAGGCCGGGG - Intergenic
907013719 1:50990528-50990550 CCCAGCACTCCGGGGGGCCGAGG - Intergenic
907038363 1:51236452-51236474 CCCGCCCCCCCGCGGGGCGGCGG - Exonic
907089758 1:51712158-51712180 CCCGGCACCTCGGGAGGCCGAGG + Intronic
907179064 1:52553571-52553593 CGCGGCGCCCAGGCGGGCTGCGG - Intergenic
907258357 1:53197117-53197139 CCTGGGACGGCGGCGGGCGGCGG - Intronic
907689225 1:56645553-56645575 CCCGGGCCTCCGGCGGGCGCGGG + Intronic
908154713 1:61341177-61341199 CCCGGCTACTCGGCAGGCGGAGG - Intronic
908446027 1:64200715-64200737 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
908467736 1:64414499-64414521 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
908473772 1:64469999-64470021 CCCGGGACGCCGGGGGCCGGGGG - Intergenic
908534895 1:65067603-65067625 CCCGGGACCCCCGGGGGCGCAGG - Intergenic
909479140 1:76113083-76113105 CCCGGCACCTCGGGAGGCCGAGG + Intronic
909641259 1:77870829-77870851 CCCGGCACCTCGGGAGGCCGAGG + Intronic
910145679 1:84077920-84077942 CCCGGGACCCCGGGGGCGGGCGG - Intergenic
910277451 1:85464668-85464690 CCAGGCAACACGGCGGCCGGCGG + Intronic
910343656 1:86215352-86215374 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
910412826 1:86964383-86964405 CCCGGCACCTCGGGAGGCCGAGG + Intronic
910676616 1:89821792-89821814 GCTGGGAGCCCGGCGGGCGGGGG + Intronic
911598467 1:99823206-99823228 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
912298646 1:108490575-108490597 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
912316860 1:108675320-108675342 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
912355647 1:109052900-109052922 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
912358304 1:109073615-109073637 CCCGGCACCTCGGGAGGCCGAGG - Intronic
912669206 1:111608646-111608668 CCCCGCACCCCGGGAGGCCGAGG + Intronic
912751568 1:112292832-112292854 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
912844151 1:113064122-113064144 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
913306343 1:117430955-117430977 CCCGGCACCTCGGGAGGCTGAGG + Intronic
913993635 1:143637326-143637348 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
914002004 1:143702314-143702336 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
914044125 1:144077268-144077290 CGCGGCACCGCGGCGGGTGGGGG - Intergenic
914230860 1:145764164-145764186 CCCGGCACCTCGGGAGGCCGAGG - Intronic
914231651 1:145767718-145767740 CCCGGCACCTCGGGAGGCCGAGG + Intronic
914468447 1:147950678-147950700 CCCGGCACCTCGGGAGGCCGAGG + Intronic
914780466 1:150781115-150781137 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
914787834 1:150850532-150850554 CCCGGCACCTCGGGAGGCCGAGG - Intronic
914887882 1:151599840-151599862 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
914965931 1:152256894-152256916 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
914987438 1:152472523-152472545 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
915208267 1:154287170-154287192 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
915502227 1:156327541-156327563 CCCGGCACCTCGGGAGGCCGGGG - Intronic
915552317 1:156642294-156642316 CCCGACCCCACGGCGGGCGGCGG - Intronic
915861457 1:159449440-159449462 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
916049937 1:161029215-161029237 CCCGGCACCTCGGGAGGCCGAGG - Intronic
916087608 1:161282132-161282154 CCCGGCACCTCGGGAGGCCGAGG + Intronic
916223308 1:162465653-162465675 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
916233393 1:162561814-162561836 CTCGGGACCCGGGCGGGCGGAGG + Intronic
916324952 1:163546261-163546283 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
916577281 1:166079181-166079203 CCCAGCAACTTGGCGGGCGGAGG - Intronic
916800134 1:168208356-168208378 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
916864029 1:168837003-168837025 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
916922684 1:169485730-169485752 CCCGGTGTCTCGGCGGGCGGCGG - Exonic
917126774 1:171694431-171694453 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
917205832 1:172571309-172571331 CCCGGCACCTCGGGAGGCCGAGG - Intronic
917376218 1:174350836-174350858 CCCGGCACCTCGGGAGGCCGAGG + Intronic
917553199 1:176057585-176057607 CCCGGCACCTCGGGAGGCCGAGG - Intronic
917859769 1:179134980-179135002 CCCGGCACCTCGGGAGGCCGAGG - Intronic
918445301 1:184611396-184611418 CCCTGCAGCCCTGCAGGCGGTGG + Intronic
919423776 1:197405326-197405348 CCCGGCACCTCGGGAGGCCGAGG - Intronic
919926018 1:202192231-202192253 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
920144021 1:203842344-203842366 CCCGGCACCTCGGGAGGCTGAGG + Intronic
920152594 1:203920422-203920444 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
920451393 1:206063642-206063664 CCCGGCACCTCGGGAGGCCGAGG - Intronic
921043799 1:211459977-211459999 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
921192667 1:212724495-212724517 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
921197975 1:212778649-212778671 CCCGGCACCTCGGGAGGCCGAGG - Intronic
921638551 1:217524606-217524628 CCCGGCACCTCGGGAGGCCGAGG + Intronic
921813932 1:219545256-219545278 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
922436844 1:225615293-225615315 CCCGGCACCTCGGGAGGCCGAGG - Intronic
922632688 1:227132381-227132403 CCCGGCACCTCGGGAGGCCGAGG - Intronic
922693310 1:227711597-227711619 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
922993110 1:229932311-229932333 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
923141133 1:231162344-231162366 CCCAGCGACCCGGCGGGTGGCGG + Intronic
923267820 1:232331319-232331341 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
923468368 1:234268200-234268222 CCCGGCACCTCGGGAGGCCGAGG + Intronic
923589759 1:235308725-235308747 CCCGGCACCTCGGGAGGCTGAGG - Intronic
923673960 1:236064729-236064751 CCCGGTGCCCCGGCGGCCAGCGG + Intronic
923710657 1:236386163-236386185 CCCGGCACCTCGGGAGGCCGAGG - Intronic
923793148 1:237128130-237128152 CCCGGCACCTCGGGAGGCCGAGG + Intronic
924362310 1:243254830-243254852 CCCGGGTCCCAGGCGGGCAGAGG + Intronic
924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG + Intronic
924943635 1:248830020-248830042 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1063084791 10:2806725-2806747 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1063459699 10:6207183-6207205 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1063744817 10:8868630-8868652 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1063944801 10:11165852-11165874 CCCGGCGGGCAGGCGGGCGGGGG - Intronic
1064108783 10:12520674-12520696 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1064109218 10:12523490-12523512 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1065055222 10:21837161-21837183 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1065594531 10:27297239-27297261 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1066085200 10:31969334-31969356 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1066952791 10:42137793-42137815 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1067026341 10:42846952-42846974 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1067114299 10:43422885-43422907 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1067120189 10:43465933-43465955 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1067339657 10:45391343-45391365 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1067391358 10:45866110-45866132 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1067871931 10:49970042-49970064 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1068969477 10:62947275-62947297 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1069157732 10:65051988-65052010 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1069645574 10:69993614-69993636 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1069732856 10:70630676-70630698 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1069741577 10:70688613-70688635 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1069930170 10:71876441-71876463 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1070135336 10:73689237-73689259 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1070629785 10:78076412-78076434 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1070966348 10:80533639-80533661 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1071289842 10:84180832-84180854 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1072013582 10:91324034-91324056 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1072180188 10:92974816-92974838 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1072291593 10:93970290-93970312 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1072602524 10:96942187-96942209 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1072684742 10:97529509-97529531 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1072772277 10:98152203-98152225 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1072956358 10:99891423-99891445 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1072980044 10:100092430-100092452 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1072999561 10:100276752-100276774 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1073122624 10:101131785-101131807 CCCGGAGGCCCGGCAGGCGGCGG + Exonic
1073238112 10:102035654-102035676 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1073274971 10:102302010-102302032 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1073385926 10:103128316-103128338 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1073450555 10:103606745-103606767 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1074587889 10:114786745-114786767 CCCGGCACCTCGGGAGGCGGAGG - Intergenic
1075054318 10:119206860-119206882 CCGCGCACCGCGGCCGGCGGGGG + Intergenic
1075061780 10:119261644-119261666 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1075128687 10:119721597-119721619 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1075181567 10:120215787-120215809 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1075407408 10:122203903-122203925 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1075842671 10:125518019-125518041 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1075901023 10:126043006-126043028 CCCTGCATCCCGGTGGGAGGAGG - Intronic
1076116895 10:127907219-127907241 CCGGGCGCCCCGGAGGGCGGCGG + Exonic
1076304043 10:129450738-129450760 CCCAGCACCCTGGGAGGCGGAGG + Intergenic
1077040098 11:517098-517120 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1077051498 11:568821-568843 CCACGCACACCCGCGGGCGGAGG - Intergenic
1077836958 11:5934256-5934278 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1077839555 11:5960509-5960531 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1078176755 11:8977623-8977645 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1079020468 11:16906571-16906593 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1079372131 11:19860776-19860798 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1079444701 11:20547999-20548021 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1080405084 11:31971756-31971778 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1080538275 11:33243336-33243358 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1080620763 11:33985804-33985826 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1080859943 11:36144179-36144201 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1080914149 11:36638148-36638170 CCTAGCACTCGGGCGGGCGGTGG - Intronic
1081288538 11:41303337-41303359 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1081627202 11:44663181-44663203 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1081793308 11:45804163-45804185 GCCGGGTCCCGGGCGGGCGGGGG + Intronic
1082064978 11:47892539-47892561 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1082706100 11:56496803-56496825 CCCGGCACCTCGGGGGGCTGAGG - Intergenic
1082811686 11:57482584-57482606 CCCGCCACCCCGTCCCGCGGCGG + Intergenic
1082871120 11:57944379-57944401 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1083042158 11:59699297-59699319 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1083114862 11:60450935-60450957 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1083118774 11:60491156-60491178 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1083130578 11:60621627-60621649 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1083154477 11:60814720-60814742 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1083208385 11:61167000-61167022 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1083382164 11:62278170-62278192 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1083646326 11:64173203-64173225 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1083831925 11:65238868-65238890 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1083936583 11:65872803-65872825 CGCGGCAGGCGGGCGGGCGGGGG - Exonic
1084388683 11:68861099-68861121 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1084924936 11:72503286-72503308 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1085097689 11:73774671-73774693 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1085112179 11:73897928-73897950 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1085116842 11:73937418-73937440 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1085292617 11:75410731-75410753 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1085443458 11:76583051-76583073 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1085480752 11:76821060-76821082 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1085492620 11:76934433-76934455 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1085563074 11:77489699-77489721 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1085754364 11:79191377-79191399 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1085791207 11:79499505-79499527 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1085822094 11:79804263-79804285 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086017090 11:82181453-82181475 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086104341 11:83132879-83132901 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086341420 11:85852624-85852646 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086434950 11:86771213-86771235 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1086697134 11:89860273-89860295 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086709025 11:89984214-89984236 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1086792708 11:91063106-91063128 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1086881361 11:92157137-92157159 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1087198447 11:95321822-95321844 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1088256996 11:107912055-107912077 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1088286196 11:108190820-108190842 CCCAGCACCCTGGGGGGCTGAGG + Intronic
1089273353 11:117316120-117316142 CTGGTCCCCCCGGCGGGCGGCGG + Exonic
1089432645 11:118436549-118436571 CCCGGGACCACCGGGGGCGGCGG + Exonic
1089432682 11:118436636-118436658 CCCGGGCCCCCGGTCGGCGGTGG + Exonic
1089510275 11:118992263-118992285 CCCGGCATCTCGGGGGGCCGAGG + Intergenic
1089520514 11:119059675-119059697 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1089585770 11:119508628-119508650 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1090152899 11:124403858-124403880 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1090322779 11:125862458-125862480 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1090686565 11:129128833-129128855 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1090762291 11:129848258-129848280 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1090791292 11:130092467-130092489 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1090907018 11:131084890-131084912 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1091378448 12:41508-41530 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1091586082 12:1817734-1817756 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1092296161 12:7200635-7200657 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1092648960 12:10612281-10612303 CCCAGCACCTCGGCAGGCTGAGG + Intronic
1092827985 12:12415294-12415316 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1093038396 12:14354323-14354345 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1093927723 12:24925840-24925862 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1094040252 12:26114406-26114428 CCCGGGGCGCTGGCGGGCGGCGG - Intergenic
1094103129 12:26784592-26784614 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1094239184 12:28201773-28201795 CCCGGCACCCCAGGAGGCCGAGG + Intronic
1094670479 12:32563746-32563768 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1094717076 12:33023374-33023396 CCCGGCACCTCGGGGGGCCGAGG + Intergenic
1095114013 12:38331018-38331040 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1095281224 12:40353729-40353751 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1095452950 12:42350710-42350732 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1095774770 12:45999909-45999931 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1096039543 12:48501255-48501277 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1096063844 12:48724316-48724338 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1096078464 12:48818809-48818831 CCCCGCAGCCCTGCGGGCGGCGG - Exonic
1096082276 12:48841711-48841733 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1096093139 12:48916345-48916367 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1096178760 12:49539372-49539394 CCCCGCACCCCGGAGGGATGGGG + Exonic
1097028660 12:56076482-56076504 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1097230664 12:57508406-57508428 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1098023019 12:66174667-66174689 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1098371036 12:69760125-69760147 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1098379655 12:69854092-69854114 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1098412479 12:70201381-70201403 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1099971232 12:89503365-89503387 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1100570880 12:95842121-95842143 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1100577738 12:95908207-95908229 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1100581890 12:95946865-95946887 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1100995380 12:100295443-100295465 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1101813600 12:108129193-108129215 CCCGGCTCCCCGGGAGGCTGCGG + Intergenic
1101885066 12:108655630-108655652 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1102175128 12:110868477-110868499 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1102186485 12:110951601-110951623 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1102268174 12:111506914-111506936 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1102294335 12:111724550-111724572 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1102587751 12:113934954-113934976 CCCAGCACCCCGGGGGGCCCAGG - Intronic
1102656388 12:114485361-114485383 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1102768314 12:115452006-115452028 CCCGGCGGCCGGGCGGGTGGCGG - Intergenic
1102854087 12:116277914-116277936 CCGGGCTCCCCGGCGGGCGGCGG + Intergenic
1103045278 12:117730758-117730780 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1103234628 12:119360881-119360903 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1103300014 12:119919481-119919503 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1103456914 12:121075588-121075610 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1103536035 12:121634450-121634472 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1103591136 12:121993217-121993239 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1103872772 12:124102688-124102710 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1103918469 12:124387839-124387861 CCCGGCACCCGGGTGGGAGAGGG + Intronic
1104748378 12:131223659-131223681 CCAGGCACCAGGGCTGGCGGTGG - Intergenic
1104861547 12:131926811-131926833 CCCGGCGCCTCGGGAGGCGGAGG + Intergenic
1104930417 12:132336592-132336614 CCCGGGACCCCGACTGGAGGTGG + Intergenic
1104930433 12:132336635-132336657 CCCGGGACCCCGACTGGCAGTGG + Intergenic
1105367569 13:19778621-19778643 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1105472095 13:20703793-20703815 CCCGGGGACCCCGCGGGCGGCGG + Intronic
1105527203 13:21187159-21187181 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1105692960 13:22859644-22859666 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1105980696 13:25513702-25513724 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1106495111 13:30269332-30269354 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1106560333 13:30840338-30840360 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1106746684 13:32715909-32715931 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1106799417 13:33241790-33241812 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1106918451 13:34540083-34540105 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1107492984 13:40899999-40900021 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1107498742 13:40954698-40954720 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1107562580 13:41571598-41571620 CCCGGCACCTCGGGAGGCGGAGG - Intronic
1107563003 13:41573870-41573892 CCCAGCACCCCGGGAGGCCGAGG - Intronic
1107692347 13:42966033-42966055 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1107831085 13:44374141-44374163 CCCTGCAGCCCGGCGGGGTGGGG + Intronic
1107863643 13:44683144-44683166 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1107953479 13:45486057-45486079 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1108330107 13:49377642-49377664 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1108351194 13:49592391-49592413 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1108608427 13:52063323-52063345 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1108610393 13:52079550-52079572 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1109316367 13:60754293-60754315 CCCAGCACTTTGGCGGGCGGAGG - Intergenic
1109994600 13:70107593-70107615 ACCGGCGGCCCGGCGGGGGGAGG - Exonic
1110318433 13:74135046-74135068 CCCGCCCCACCGGCGCGCGGGGG - Intergenic
1110506611 13:76294939-76294961 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1111230727 13:85341252-85341274 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1112056299 13:95691800-95691822 CCCGGCACCTTGGGAGGCGGAGG + Intronic
1112077395 13:95928940-95928962 CCCGGCACCTCGGGAGGCCGGGG + Intronic
1112091665 13:96090358-96090380 CCCGCCGCCCCGGCCGGCCGCGG - Intergenic
1112290792 13:98143043-98143065 GCCGGCCCCTCGGCGGGGGGAGG - Intronic
1113656025 13:112068175-112068197 CCAGGCGGCGCGGCGGGCGGCGG + Exonic
1113939105 13:114009348-114009370 CACGGCACACGGGCGGTCGGAGG + Intronic
1114137140 14:19865960-19865982 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1114165052 14:20212310-20212332 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1114280390 14:21188467-21188489 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1114336577 14:21697539-21697561 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1114427545 14:22636664-22636686 CCCGGCACCCCGGGAGGCTGAGG - Intergenic
1114507776 14:23231890-23231912 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1115259580 14:31437919-31437941 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1115399256 14:32939170-32939192 CTGGGCTGCCCGGCGGGCGGTGG - Intronic
1115547337 14:34475711-34475733 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1115622442 14:35153135-35153157 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1115703870 14:35978378-35978400 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1116005481 14:39286190-39286212 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1116192171 14:41675348-41675370 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1116409000 14:44601027-44601049 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1116502019 14:45634767-45634789 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1116835651 14:49767553-49767575 CTCTGCAGCCCGGCTGGCGGCGG + Intergenic
1116959742 14:50956978-50957000 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1117276881 14:54202869-54202891 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1117723158 14:58646550-58646572 CCCGGCAGGCCCGCGGGCGGGGG + Exonic
1118148475 14:63165087-63165109 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1118184038 14:63522194-63522216 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1118209465 14:63751803-63751825 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1118239116 14:64038587-64038609 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1118253390 14:64183661-64183683 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1118517856 14:66546516-66546538 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1118584579 14:67340924-67340946 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1119254714 14:73185351-73185373 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1119595115 14:75925796-75925818 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1119722142 14:76898614-76898636 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1119835620 14:77747167-77747189 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1120086972 14:80286248-80286270 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1120170659 14:81244995-81245017 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1120547713 14:85830398-85830420 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1120892754 14:89505525-89505547 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1121306923 14:92912438-92912460 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1121531466 14:94657674-94657696 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1121751739 14:96363377-96363399 CCCGGCGCGCCGCCGGGCGCTGG + Exonic
1122212180 14:100180539-100180561 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1122568665 14:102677946-102677968 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1122582285 14:102778023-102778045 CCCGGCACCCCGCGGGGCCGCGG + Intronic
1122662909 14:103309834-103309856 CCCGGCACCCTGGCTGGAGCTGG - Intergenic
1122931105 14:104933435-104933457 CGCGGCAGCCCGGCGCGGGGTGG - Exonic
1122957882 14:105079796-105079818 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1202848009 14_GL000009v2_random:199679-199701 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1202917487 14_GL000194v1_random:190232-190254 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1123429808 15:20204526-20204548 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1123470938 15:20551507-20551529 CCCAGCACCCCGGGAGGCCGTGG - Intergenic
1123474434 15:20579900-20579922 CCCAGCACCCCGGGAGGCCGAGG + Intergenic
1123643578 15:22420453-22420475 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1123647120 15:22449193-22449215 CCCAGCACCCCGGGAGGCCGTGG + Intergenic
1123722144 15:23069139-23069161 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1123731241 15:23146495-23146517 CCCAGCACCCCGGGAGGCCGTGG - Intergenic
1123734824 15:23175399-23175421 CCCAGCACCCCGGGAGGCTGAGG + Intergenic
1123749379 15:23343910-23343932 CCCAGCACCCCGGGAGGCCGTGG - Intergenic
1123752990 15:23373012-23373034 CCCAGCACCCCGGGAGGCCGAGG + Intergenic
1123753075 15:23373470-23373492 CCCAGCACCCCGGGAGGCCGAGG + Intergenic
1124245687 15:28069652-28069674 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1124281750 15:28367787-28367809 CCCAGCACCCCGGGAGGCCGTGG - Intergenic
1124285326 15:28396699-28396721 CCCAGCACCCCGGGAGGCTGAGG + Intergenic
1124297371 15:28514926-28514948 CCCAGCACCCCGGGAGGCTGAGG - Intergenic
1124300953 15:28543817-28543839 CCCAGCACCCCGGGAGGCCGTGG + Intergenic
1124322686 15:28726734-28726756 CCCAGCACCCAGGGAGGCGGAGG - Intronic
1124328062 15:28783977-28783999 CCCAGCACCCTGGGAGGCGGAGG - Intergenic
1124335201 15:28850386-28850408 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1124523517 15:30426868-30426890 CCCAGCACCCAGGGAGGCGGAGG - Intergenic
1124523595 15:30427312-30427334 CCCAGCACCCAGGGAGGCGGAGG - Intergenic
1124535072 15:30538903-30538925 CCCAGCACCCAGGGAGGCGGAGG + Intergenic
1124535150 15:30539346-30539368 CCCAGCACCCAGGGAGGCGGAGG + Intergenic
1124574658 15:30896831-30896853 CCCAGCACCCCGGGAGGCCGAGG + Intergenic
1124607771 15:31184216-31184238 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1124763503 15:32468251-32468273 CCCAGCACCCAGGGAGGCGGAGG - Intergenic
1124763578 15:32468698-32468720 CCCAGCACCCAGGGAGGCGGAGG - Intergenic
1124775048 15:32580353-32580375 CCCAGCACCCAGGGAGGCGGAGG + Intergenic
1124775125 15:32580798-32580820 CCCAGCACCCAGGGAGGCGGAGG + Intergenic
1125566431 15:40682343-40682365 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1125651337 15:41320528-41320550 CCCGGCACCCTGGGAGGCCGAGG - Intronic
1125861432 15:43004629-43004651 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1125862680 15:43014132-43014154 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1125878139 15:43167869-43167891 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1126210823 15:46098548-46098570 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1126517322 15:49551027-49551049 CCCGGCACCCCGGGAGGCCGAGG + Intronic
1126752036 15:51886412-51886434 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1126816638 15:52460392-52460414 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1127023933 15:54781842-54781864 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1127072777 15:55302324-55302346 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1127153972 15:56109296-56109318 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1127674638 15:61228293-61228315 CCCGGCGCCCAGGCTGGCGGGGG - Intronic
1127783091 15:62333036-62333058 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1127824467 15:62690758-62690780 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1127874186 15:63098525-63098547 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1128597596 15:68965259-68965281 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1129008618 15:72396105-72396127 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1129313653 15:74728522-74728544 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1129791204 15:78341629-78341651 CCAGGGACCCGGGCGGGCGCGGG - Intronic
1130071029 15:80647204-80647226 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1130340962 15:82998916-82998938 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1130370869 15:83284539-83284561 CCCGGCACCGCAGCGGTCGCAGG - Exonic
1130428493 15:83822940-83822962 CCCGGCACCTCGGGAGGCGGAGG + Intronic
1130522301 15:84672517-84672539 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1130946854 15:88554224-88554246 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1131001541 15:88942456-88942478 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1131043996 15:89297506-89297528 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1131479499 15:92769065-92769087 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1131839011 15:96416666-96416688 CCCGGGACGCGGGCGGGTGGGGG - Intergenic
1132300889 15:100774741-100774763 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1132475934 16:138262-138284 CCCGGCCCCACGGCGGGATGCGG - Exonic
1132527689 16:425796-425818 CCCGGCGGCGCGGCGGGCGCAGG - Exonic
1132679968 16:1135818-1135840 CCCAGCACCTCGGCAGGTGGAGG - Intergenic
1132873231 16:2124751-2124773 CCCGGCACCCCCGCCCGCGCTGG + Intronic
1132885415 16:2180122-2180144 CCCAGGCCCCCGGCGGGCAGTGG + Exonic
1132921942 16:2400508-2400530 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1132992374 16:2802627-2802649 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1133680293 16:8114664-8114686 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1133752214 16:8733577-8733599 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1134015992 16:10888807-10888829 CCCAGCACCCCGGCGAGGGAAGG - Intronic
1134082895 16:11336448-11336470 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1134398715 16:13889321-13889343 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1134552319 16:15143930-15143952 CCCGGCACCCCTGCCCGCGCTGG + Intergenic
1134854420 16:17506555-17506577 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1135575512 16:23583067-23583089 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1135694644 16:24575508-24575530 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1136160430 16:28416096-28416118 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1136202665 16:28699218-28699240 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1136572005 16:31103883-31103905 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
1136573182 16:31108770-31108792 CCCGGGACCCCGGGGCGCTGGGG + Intronic
1136593440 16:31231856-31231878 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1137240915 16:46653869-46653891 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1137303769 16:47180633-47180655 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1137426390 16:48384866-48384888 CCCGCCTCCCGGGCGCGCGGGGG + Intronic
1137493363 16:48951346-48951368 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1138028102 16:53538827-53538849 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1138400695 16:56740771-56740793 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1138642709 16:58397552-58397574 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1139378267 16:66514369-66514391 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1139394643 16:66630588-66630610 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1139556210 16:67712537-67712559 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1139888082 16:70225202-70225224 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1140063178 16:71589089-71589111 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1140661045 16:77191512-77191534 CCCGGCCCCCGGGGGCGCGGAGG + Exonic
1141132622 16:81445783-81445805 CCAGGCACCCAGCCTGGCGGTGG - Intronic
1141728852 16:85808720-85808742 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG + Intronic
1142332206 16:89462319-89462341 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1142529741 17:571793-571815 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1142533489 17:598211-598233 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1142629482 17:1215489-1215511 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1142657523 17:1403765-1403787 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1142763748 17:2055149-2055171 ACCGGGGGCCCGGCGGGCGGAGG + Intronic
1142799719 17:2337571-2337593 GCCGGGAGCGCGGCGGGCGGGGG + Exonic
1142811795 17:2399016-2399038 GCCGCCGCCGCGGCGGGCGGGGG - Intronic
1142818437 17:2446831-2446853 CCCGGCACCCCGGGAGGCCGAGG - Intronic
1142850085 17:2700622-2700644 CCCAGCACCCAGGAGGGCAGGGG + Intronic
1142940015 17:3372569-3372591 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1142963317 17:3564753-3564775 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1143115360 17:4578772-4578794 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1143150880 17:4807189-4807211 TCCGGAACCCCCGCGGGCGCTGG + Exonic
1143277320 17:5721646-5721668 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1143667588 17:8373424-8373446 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1143689534 17:8549938-8549960 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1144500861 17:15786261-15786283 CCTGGGACCGCGGGGGGCGGGGG - Intergenic
1144509902 17:15867035-15867057 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1144775371 17:17782408-17782430 GCGGGCACCCCGCCCGGCGGAGG - Intronic
1144799108 17:17912931-17912953 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1144866264 17:18337822-18337844 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1145022151 17:19441070-19441092 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1145026966 17:19475609-19475631 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1145047413 17:19628639-19628661 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1145163022 17:20588923-20588945 CCTGGGACCGCGGGGGGCGGGGG - Intergenic
1145174007 17:20684654-20684676 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1145214649 17:21042637-21042659 CCCGGCAGCCCACCGCGCGGCGG - Intronic
1145684116 17:26637791-26637813 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1145717066 17:27033363-27033385 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1145733525 17:27211641-27211663 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1145862693 17:28223316-28223338 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1145920382 17:28605000-28605022 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1146048996 17:29533586-29533608 CCTGGCACCTCGGGAGGCGGAGG + Intronic
1146053002 17:29567442-29567464 CCCGGGACCCCGTGGGGCGGCGG + Intronic
1146155758 17:30522982-30523004 CCCGGCACCTCGGGAGGCCGAGG - Exonic
1146216550 17:30981105-30981127 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1146444630 17:32923566-32923588 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1146731416 17:35195759-35195781 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1147142311 17:38466565-38466587 CCAGGTACCCCGCCGGGCGGGGG + Exonic
1147277780 17:39333395-39333417 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1147636316 17:41966728-41966750 GCGGGCACCCGGGCGGGCTGGGG - Exonic
1147648863 17:42050669-42050691 CCCGGGACCCTGGCCGGCGCTGG - Intronic
1147784942 17:42972572-42972594 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1147974052 17:44237667-44237689 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1147986043 17:44308452-44308474 CCGGGCCCCACGGAGGGCGGAGG - Intronic
1148016200 17:44524275-44524297 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1148269707 17:46253494-46253516 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1148404141 17:47397262-47397284 CCCGGCACCCCGGGAGGCCGAGG - Intronic
1148608011 17:48944748-48944770 CCCGGCAGCCGGGCGGCCCGCGG - Exonic
1148852261 17:50560977-50560999 CCCGGCTCCGCGCCAGGCGGCGG - Intergenic
1149625229 17:58074958-58074980 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1149632905 17:58142079-58142101 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1149780772 17:59394834-59394856 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1149793500 17:59499704-59499726 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1150211785 17:63445983-63446005 CCCGGCACCCGGGCAGGCCAGGG + Exonic
1150380515 17:64716273-64716295 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1150643689 17:66965493-66965515 GCCGGCACCCCCGGGGGAGGTGG + Intronic
1152019984 17:77775917-77775939 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1152129020 17:78465180-78465202 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1152211016 17:79003365-79003387 CCAGGCACCCCGGCAGCCAGTGG - Intronic
1152407839 17:80107719-80107741 CACGGTACAGCGGCGGGCGGCGG + Intergenic
1152479037 17:80537774-80537796 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1152617842 17:81346046-81346068 CTGGGCGCCCCGGAGGGCGGCGG - Intergenic
1152672574 17:81617907-81617929 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1152696343 17:81798606-81798628 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1153221850 18:2868541-2868563 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1153633940 18:7098099-7098121 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1153636479 18:7117605-7117627 CCCCGCAGGCGGGCGGGCGGGGG - Intronic
1153646927 18:7203980-7204002 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1153900614 18:9614504-9614526 CCCGGCTCCCCGGGCGGCCGCGG - Exonic
1154278773 18:12981449-12981471 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1154290076 18:13098925-13098947 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1154398459 18:14011596-14011618 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1154943600 18:21138221-21138243 CCCAGCACCCCGGGAGGCCGAGG + Intergenic
1155461777 18:26091128-26091150 CCCGGCAGCCCGGAGAGGGGAGG + Intronic
1156502013 18:37566131-37566153 GCCCGCGCCACGGCGGGCGGCGG + Intergenic
1157629604 18:49081249-49081271 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1157705068 18:49799465-49799487 CCCAGCACCCCGGGAGGCCGAGG - Intronic
1158148430 18:54342711-54342733 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1158434915 18:57428687-57428709 CCCCGCAGCTCGGCAGGCGGAGG - Intergenic
1158459464 18:57633617-57633639 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1159045591 18:63366744-63366766 CCCGGGAACCCTGCGGCCGGCGG + Intronic
1159340570 18:67127422-67127444 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1160228518 18:77029156-77029178 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1160465589 18:79073374-79073396 CCCAGCACCCCGGGAGGCCGAGG + Intronic
1160577244 18:79863680-79863702 CCCTGCTCCCCGGGCGGCGGCGG + Exonic
1160664714 19:320122-320144 CCCGGCACTCTGGGGGGCTGAGG + Intronic
1160789927 19:918609-918631 CCCAGCACCCAGCCGGGCAGCGG - Exonic
1160887048 19:1354969-1354991 CCCGGCCCCGCGGGGAGCGGCGG + Intronic
1160904843 19:1447173-1447195 CCCGGCCACCCAGCCGGCGGCGG + Intronic
1161041220 19:2111635-2111657 CCAGGAACCCCGGCGTGGGGCGG + Intronic
1161067898 19:2247579-2247601 CTCGGCACCTGGGAGGGCGGGGG - Exonic
1161087299 19:2341029-2341051 CCCCGGGCCCCGGCGGGCAGCGG + Exonic
1161264980 19:3359860-3359882 CCCCGCACCCCGGCTGGGGGCGG + Intronic
1161648636 19:5470329-5470351 CCCAGCACTCCGGGAGGCGGAGG - Intergenic
1161685654 19:5701581-5701603 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1161717409 19:5884362-5884384 CCCAGCACCTTGGCAGGCGGAGG - Intronic
1162254999 19:9482913-9482935 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1162278850 19:9679591-9679613 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1162435369 19:10654770-10654792 CGCGGCCCCTCGGCCGGCGGCGG + Intronic
1162538304 19:11277231-11277253 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1162914059 19:13865154-13865176 CCCCGCGCCGCGCCGGGCGGTGG - Intronic
1163142925 19:15362608-15362630 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1163346944 19:16749365-16749387 CGCGGCTCCACGGCAGGCGGTGG - Exonic
1163558634 19:18006372-18006394 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1163865432 19:19769742-19769764 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1163913002 19:20214147-20214169 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164040314 19:21487483-21487505 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1164047132 19:21551991-21552013 CCCGGCACCTCGGGGGGCTGAGG + Intronic
1164054919 19:21614541-21614563 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164064921 19:21707602-21707624 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164066316 19:21720599-21720621 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164071713 19:21775444-21775466 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164081948 19:21866613-21866635 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1164105150 19:22104697-22104719 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164186317 19:22872144-22872166 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1164217385 19:23161552-23161574 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1164244562 19:23418905-23418927 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1164263812 19:23594409-23594431 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1164658637 19:29942692-29942714 AGGGGCAGCCCGGCGGGCGGAGG - Intronic
1164713207 19:30373941-30373963 CCCGGAAAACAGGCGGGCGGCGG - Intronic
1165070006 19:33249530-33249552 CCCGGCACCCACGAGGGCTGGGG + Intergenic
1165199255 19:34132122-34132144 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1165295547 19:34922757-34922779 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1165482016 19:36069736-36069758 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1165540708 19:36490724-36490746 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1165727839 19:38124747-38124769 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1165768419 19:38364667-38364689 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1165842772 19:38798557-38798579 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1166028758 19:40109462-40109484 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1166029643 19:40117430-40117452 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1166115174 19:40648914-40648936 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1166163226 19:40967169-40967191 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1166182128 19:41116490-41116512 CCTGGGACCCAGGCGGGTGGTGG + Exonic
1166305700 19:41935871-41935893 CCGGGCAGCCCGCCGGGTGGGGG - Intergenic
1166367387 19:42284432-42284454 CCCCGCCCCCCGGCGCGCGCGGG - Intronic
1166418153 19:42611016-42611038 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1166547033 19:43639876-43639898 CCCCGCCCCCGGGCGGGCAGGGG - Intergenic
1167505203 19:49867531-49867553 GCCTGCAACCCGGCCGGCGGCGG + Exonic
1167540767 19:50086005-50086027 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1167574704 19:50312477-50312499 GCAGGCACCCTGGCGGCCGGGGG + Intronic
1167578465 19:50328896-50328918 CCCGGCACCCCGCGGGCCCGGGG - Exonic
1167907719 19:52676231-52676253 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1167924384 19:52811142-52811164 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1167937325 19:52919408-52919430 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1167971180 19:53188325-53188347 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1167975389 19:53222520-53222542 CCCGGCACCTCGGGAGGCGGAGG - Intergenic
1167980379 19:53270415-53270437 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1168572501 19:57482829-57482851 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1168658177 19:58146801-58146823 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1168696359 19:58406091-58406113 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1202683546 1_KI270712v1_random:30239-30261 CGCGGCACCGGGGCGGGTGGGGG - Intergenic
925035283 2:680257-680279 CCTGGCACCCCGGCTGGCATGGG - Intergenic
925400612 2:3569738-3569760 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
925403754 2:3591991-3592013 CCCGGCACCCCGGGAGGCCGAGG + Intergenic
926215664 2:10903613-10903635 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
926252886 2:11165761-11165783 CCCGGCACCTCGGGAGGCCGAGG + Intronic
926675179 2:15612752-15612774 CCCGGCACCTCGGGAGGCCGAGG + Intronic
927468079 2:23351726-23351748 CCCGGCATCTCTGCGGCCGGAGG + Intergenic
927747262 2:25634051-25634073 CCCGGCAGCCAGGAGGGAGGTGG + Intronic
927755522 2:25705335-25705357 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
927757972 2:25723908-25723930 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
927777167 2:25911352-25911374 CCCGGCACCCCGGGAGGCCGAGG + Intergenic
927833456 2:26371606-26371628 CCCGGCACCTCGGGAGGCCGAGG + Intronic
927978606 2:27359005-27359027 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
928003357 2:27541134-27541156 CCCGGCACCTCGGGAGGCCGAGG + Intronic
928005567 2:27558646-27558668 CCCGGCACCTCGGGAGGCCGAGG + Intronic
928009607 2:27594876-27594898 CCCAGCACCTCGGGAGGCGGAGG + Intronic
928149273 2:28811208-28811230 CCCGCTACGCCGCCGGGCGGAGG - Intronic
928558237 2:32448396-32448418 CCCGGCACCTCGGGAGGCCGAGG + Intronic
928561657 2:32494649-32494671 CCCGGCACCCTGGGAGGCTGAGG + Intronic
929062155 2:37933517-37933539 CCCGGCACCTCGGGAGGCCGAGG + Intronic
929110541 2:38402946-38402968 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
929238451 2:39628935-39628957 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
929415870 2:41746328-41746350 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
929445111 2:41995298-41995320 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
929448012 2:42015352-42015374 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
929516394 2:42606825-42606847 CCCGGCACCTCGGGAGGCCGAGG + Intronic
929518019 2:42622150-42622172 CCCGGCACCTCGGGAGGCCGAGG + Intronic
929604658 2:43226536-43226558 CCGGGCACCCCGGGGCGCGGAGG - Exonic
929857766 2:45650879-45650901 CGCGGGACCCCGGGGTGCGGCGG - Intergenic
929899206 2:45986779-45986801 CCCGGCACCCCTGGAGGTGGGGG + Intronic
930079500 2:47434271-47434293 CCCGGCACCTCGGGAGGCCGAGG + Intronic
930202416 2:48557680-48557702 CCCGGCACCTCGGGAGGCCGAGG + Intronic
930208951 2:48615218-48615240 CCCGGCACCTCGGGAGGCCGAGG + Intronic
930396504 2:50828974-50828996 CCCGGCACCTCGGGAGGCCGAGG + Intronic
930665701 2:54096578-54096600 CCCGGCACCTCGGGAGGCCGAGG + Intronic
930730707 2:54725019-54725041 CCCGGCGCGCGGGGGGGCGGGGG + Exonic
930834080 2:55774487-55774509 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
931326913 2:61235439-61235461 CCCAGCACCTCGGGAGGCGGAGG - Intronic
931576282 2:63721979-63722001 CCCGGCACCTCGGGAGGCCGAGG - Intronic
931584128 2:63808592-63808614 CCCGGCACCTCGGGAGGCCGAGG - Intronic
931604866 2:64042207-64042229 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
931656435 2:64512965-64512987 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
931751955 2:65338548-65338570 CCCGGCACCTCGGGAGGCCGAGG - Intronic
932313915 2:70767466-70767488 ACCGCTACCCCGGAGGGCGGCGG + Intronic
932367139 2:71160704-71160726 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
932710945 2:74062166-74062188 CCCGGCACCTCGGGAGGCCGAGG + Intronic
932903361 2:75724844-75724866 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
933734846 2:85487314-85487336 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
933751079 2:85602474-85602496 CCCCGCGCCCAGGCGAGCGGGGG - Intronic
933762586 2:85682647-85682669 CCCAGCACCCTGGGAGGCGGAGG + Intergenic
934248228 2:90324839-90324861 CGCGGCACCGGGGCGGGTGGGGG + Intergenic
934703325 2:96461042-96461064 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
934763942 2:96870048-96870070 CGCGCCACCACGGCGGGCGCCGG + Intronic
935653117 2:105398967-105398989 CACGGCACCGCAGCGGGCCGGGG + Intronic
936158321 2:110064388-110064410 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
936345507 2:111672326-111672348 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
937168880 2:119844998-119845020 CCCGGCACCTCGGGAGGCCGAGG + Intronic
937221731 2:120346040-120346062 CCCGGCGGGCGGGCGGGCGGAGG + Intergenic
937437477 2:121892315-121892337 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
937995986 2:127695537-127695559 CCCGGGACCCCGCCGGCCGCGGG - Intergenic
938006298 2:127789446-127789468 CCCGGCACCTCGGGAGGCTGAGG + Intronic
938307671 2:130266138-130266160 CCCGGCACCCAGGCAGTGGGAGG + Intergenic
938533671 2:132220614-132220636 CCCGGCACCTCGGGAGGCCGAGG - Intronic
938829241 2:135034553-135034575 CCCGGCACCTCGGGAGGCCGAGG + Intronic
939477166 2:142702168-142702190 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
940635465 2:156293112-156293134 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
940643137 2:156367811-156367833 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
940817404 2:158311217-158311239 CCCGGCACCTCGGGAGGCCGAGG + Intronic
941197462 2:162469957-162469979 CCCGGCACCTCGGGAGGCCGAGG - Intronic
941603327 2:167564608-167564630 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
941786506 2:169505205-169505227 CCCGGCACCTCGGGAGGCCGAGG - Exonic
941814936 2:169787117-169787139 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
941822477 2:169856578-169856600 CCCGGCACCTCGGGAGGCCGAGG + Intronic
942012086 2:171774320-171774342 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
942355530 2:175107817-175107839 CCTGGCACCTCGGGGGGCCGAGG - Intronic
942459108 2:176157417-176157439 CCCCGGCCCCCGGCGGGCGCGGG + Intronic
942621155 2:177845776-177845798 CCCGGCACCTCGGGAGGCCGAGG + Intronic
943740144 2:191399011-191399033 CCCGGCACCTCGGGAGGCCGAGG + Intronic
943773257 2:191741467-191741489 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
943863093 2:192893730-192893752 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
944060580 2:195567433-195567455 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
944255207 2:197618336-197618358 CCCGGCACCTCGGGAGGCCGAGG - Intronic
944533173 2:200684497-200684519 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
944570734 2:201042206-201042228 CCCGGCACCTCGGGAGGCCGAGG - Intronic
944585239 2:201166712-201166734 CCCGGCACCTCGGGAGGCCGAGG + Exonic
944598998 2:201284421-201284443 CCCGGCACCTCGGGAGGCCGAGG + Intronic
944733186 2:202535830-202535852 CCCGGCACCTCGGGAGGCCGAGG + Intronic
944751702 2:202715827-202715849 CCCGGCACCTCGGGAGGCCGAGG + Intronic
944797828 2:203206669-203206691 CCCGGCACCTCGGGAGGCCGAGG - Intronic
944815703 2:203373208-203373230 CCCGGCACCTCGGGAGGCCGAGG + Intronic
945090493 2:206172344-206172366 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
945110773 2:206357500-206357522 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
945232826 2:207610048-207610070 CCCGGCACCTCGGGAGGCCGAGG - Exonic
945316776 2:208378118-208378140 CCCGGCACCTCGGGAGGCCGAGG + Intronic
945530692 2:210950391-210950413 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
945835940 2:214836099-214836121 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
945970565 2:216227300-216227322 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
946196155 2:218033980-218034002 CCTGGCGCCCCGGCGGGCAGGGG + Intergenic
946304067 2:218846150-218846172 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
946318014 2:218931049-218931071 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
946650837 2:221891745-221891767 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
946742460 2:222815807-222815829 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
946751593 2:222897667-222897689 CCCGGCACCTCGGGAGGCCGAGG + Intronic
947229560 2:227871518-227871540 CCCGGGGCTCCGGCGCGCGGGGG - Intronic
947724252 2:232387593-232387615 CCCGGAACCCCGTCGGGCTGCGG - Intergenic
947901517 2:233724944-233724966 CCCGGCACCTCGGGAGGCCGAGG + Intronic
948000329 2:234562416-234562438 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
948651775 2:239450123-239450145 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1168757248 20:325975-325997 CCCGGGACCCGGGCCGGCCGAGG + Exonic
1169108978 20:3019819-3019841 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1169231146 20:3889555-3889577 CCGGGGACCCCGAAGGGCGGCGG + Exonic
1169246768 20:4032100-4032122 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1169370706 20:5027135-5027157 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1169420050 20:5452549-5452571 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
1169441884 20:5639746-5639768 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1169449765 20:5701602-5701624 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1169788576 20:9386000-9386022 CCCAGCACCCCGGGAGGCCGAGG + Intronic
1169885744 20:10395524-10395546 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1170578226 20:17680743-17680765 TCCGGCACTGCGGCGGGCGCGGG - Intronic
1170592094 20:17778827-17778849 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1170645590 20:18194156-18194178 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1170664649 20:18376040-18376062 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1171366257 20:24626821-24626843 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1171496704 20:25561287-25561309 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1171951507 20:31426550-31426572 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1171957620 20:31472148-31472170 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1172051750 20:32122914-32122936 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1172141051 20:32723384-32723406 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172199494 20:33115213-33115235 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1172209339 20:33185940-33185962 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1172279830 20:33701026-33701048 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1172337780 20:34132095-34132117 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1172348426 20:34222878-34222900 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172401830 20:34658243-34658265 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172465424 20:35153113-35153135 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1172717873 20:36977400-36977422 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1172720854 20:36999742-36999764 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172722660 20:37012113-37012135 CCCGGCACCTCGGCAGGCCGAGG - Intronic
1172728765 20:37069088-37069110 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172735703 20:37125470-37125492 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172738900 20:37150537-37150559 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1172907116 20:38378420-38378442 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1172918695 20:38462286-38462308 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1173273291 20:41555997-41556019 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1173508561 20:43607892-43607914 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1173769714 20:45646523-45646545 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1173865009 20:46307926-46307948 TCCGGGACCCCCGCGGGCCGAGG - Intronic
1174405280 20:50298911-50298933 CCACGCACCCCGGCAGGCAGAGG + Intergenic
1174835717 20:53854066-53854088 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1175183640 20:57165616-57165638 CCAGGCACCATGGCGGGCAGTGG - Intergenic
1175877784 20:62238629-62238651 CCCGGGACCCCGGCGAGCTGCGG + Intronic
1176104173 20:63377896-63377918 CCCCGCACCCCGGTGTGCAGGGG - Intronic
1176550055 21:8217084-8217106 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1176550088 21:8217180-8217202 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176550872 21:8220530-8220552 CCCAGCTCCACGGCGGGCCGAGG - Intergenic
1176568982 21:8400119-8400141 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1176569015 21:8400215-8400237 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176569670 21:8402797-8402819 CCCAGCTCCACGGCGGGCCGAGG - Intergenic
1176576896 21:8444354-8444376 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1176576929 21:8444450-8444472 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1177134316 21:17292838-17292860 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1177788413 21:25696133-25696155 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1178034267 21:28563460-28563482 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1178873235 21:36392957-36392979 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1179718239 21:43301143-43301165 CCCGGCAACCCGGCTTCCGGTGG - Intergenic
1179842764 21:44087968-44087990 CCCAGCAGGCAGGCGGGCGGCGG - Intronic
1180064611 21:45405974-45405996 CCCGACACCACGGCGGGCGCGGG - Intronic
1180068231 21:45423496-45423518 CCGGGCCCTCCGGGGGGCGGGGG - Intronic
1180080680 21:45486323-45486345 CCTGGCTCCCCGGCAGGCGAGGG - Intronic
1180124970 21:45784711-45784733 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1180739400 22:18042132-18042154 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1180762279 22:18219853-18219875 CCCCGCACCCGGGCGGAGGGCGG + Intergenic
1180773388 22:18404755-18404777 CCCCGCACCCGGGCGGAGGGCGG - Intergenic
1180804739 22:18654304-18654326 CCCCGCACCCGGGCGGAGGGCGG - Intergenic
1180806005 22:18715106-18715128 CCCCGCACCCGGGCGGAGGGCGG + Intergenic
1180831906 22:18910872-18910894 CCCGGCCCCACGGCAGGCGGTGG + Exonic
1180861166 22:19083970-19083992 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1181192484 22:21151688-21151710 CCCCGCACCCGGGCGGAGGGCGG - Intergenic
1181216955 22:21340887-21340909 CCCCGCACCCGGGCGGAGGGCGG + Intergenic
1181274058 22:21677442-21677464 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1181301653 22:21884526-21884548 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1181373974 22:22441407-22441429 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1181478203 22:23181279-23181301 TCGGGCTCCTCGGCGGGCGGCGG - Exonic
1181585988 22:23854066-23854088 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1181617673 22:24065749-24065771 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1181658140 22:24318266-24318288 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1181749110 22:24976642-24976664 CCCAGCACCCCTGTGGGTGGAGG + Intronic
1181792434 22:25278367-25278389 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1182199249 22:28553037-28553059 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1182343752 22:29644666-29644688 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1182355344 22:29720244-29720266 CCCGGCGGCCCGGGGCGCGGGGG + Exonic
1182377515 22:29858712-29858734 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1182484672 22:30632236-30632258 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1182538762 22:31026529-31026551 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1182976429 22:34626720-34626742 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1182982558 22:34685020-34685042 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1183201390 22:36387679-36387701 CCCGCCACCCGCGCGGGCGGGGG - Intronic
1183394944 22:37566353-37566375 CCCGGCCCCCAGGGGGGCAGAGG + Exonic
1183434634 22:37786477-37786499 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1183537305 22:38410443-38410465 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1183595093 22:38806545-38806567 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1183871848 22:40746140-40746162 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1183939522 22:41285570-41285592 CCCGGGGCCCCCGCGGGCGTGGG + Intronic
1183940821 22:41294302-41294324 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1184080934 22:42219738-42219760 CCCAGCACCTCGGGGGGCTGAGG + Intronic
1184100303 22:42338459-42338481 CCCGGCAGCCCGGCCTGCAGGGG + Intronic
1184145379 22:42607361-42607383 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1184169567 22:42750992-42751014 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1184202496 22:42980737-42980759 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG + Intergenic
1184276477 22:43411943-43411965 CGCGGCGCGCGGGCGGGCGGCGG + Intronic
1184620370 22:45672079-45672101 CCCGACAGCCTGGCAGGCGGCGG - Exonic
1184840573 22:47050253-47050275 CCCAGCACCCTGGGGGGCCGAGG - Intronic
1185206538 22:49542013-49542035 CCCAGCAGCCTGGGGGGCGGGGG - Intronic
1185255119 22:49827522-49827544 CCCGGCAAGCGGGCGGGCGCGGG + Intergenic
1185321399 22:50201647-50201669 CCCAACACCGCGCCGGGCGGAGG - Intronic
1185369901 22:50456174-50456196 CCCAGCACCAAGGCGGGCAGAGG + Intronic
1203235218 22_KI270731v1_random:145737-145759 CCCCGCACCCGGGCGGAGGGCGG - Intergenic
1203247741 22_KI270733v1_random:85865-85887 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1203254945 22_KI270733v1_random:133410-133432 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1203254978 22_KI270733v1_random:133506-133528 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203255775 22_KI270733v1_random:136854-136876 CCCAGCTCCACGGCGGGCCGAGG - Intergenic
1203255884 22_KI270733v1_random:137539-137561 CCCAGCTCCACGGCGGGCCGAGG - Intergenic
1203263001 22_KI270733v1_random:178489-178511 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1203263034 22_KI270733v1_random:178585-178607 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203281984 22_KI270734v1_random:136143-136165 CCCGGCCCCACGGCAGGCGGTGG + Intergenic
949330539 3:2917047-2917069 CCCGGCACCTCGGGAGGCCGAGG + Intronic
949414386 3:3799857-3799879 CCCGGCACCCACGGCGGCGGCGG - Exonic
949551269 3:5114399-5114421 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
949565752 3:5243225-5243247 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
949570112 3:5284469-5284491 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
949853209 3:8439302-8439324 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
949988638 3:9559647-9559669 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
949992546 3:9591547-9591569 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
950044373 3:9940413-9940435 CCCGGCACCTCGGGAGGCCGAGG + Intronic
950060703 3:10069712-10069734 CCCGGCACCTCGGGAGGCTGAGG - Intronic
950412840 3:12850267-12850289 CCCGGCACCTCGGGAGGCCGAGG + Intronic
950755030 3:15163886-15163908 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
950819395 3:15741987-15742009 CCCGGCACCTCGGGAGGCCGAGG - Intronic
950949289 3:16980881-16980903 CCCGGCACCTCGGGAGGCCGAGG + Intronic
951290605 3:20867535-20867557 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
951550652 3:23872118-23872140 CCCGGCACCTCGGGAGGCCGAGG + Intronic
952364586 3:32663725-32663747 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
952894111 3:38065084-38065106 CCCGGCACCTCGGGAGGCTGAGG + Intronic
953037670 3:39227312-39227334 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
953084770 3:39655542-39655564 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
953257460 3:41305470-41305492 CCCGGCACCTCGGGAGGCCGAGG - Intronic
953306969 3:41840624-41840646 CCCAGCACCCCGGGAGGCCGAGG - Intronic
953322405 3:41983791-41983813 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
953425879 3:42797198-42797220 CCCGGCACCTCGGGAGGCCGAGG - Intronic
953652881 3:44821869-44821891 CCCGGCACCTCGGGAGGCCGAGG + Intronic
953854985 3:46494164-46494186 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
953909250 3:46883421-46883443 CCCGGCGTCCCGGCGGCCCGAGG - Exonic
953922700 3:46963706-46963728 CCCGGCACCTCGGGAGGCCGAGG - Intronic
953959403 3:47256010-47256032 CCCGGCACCTCGGGAGGCCGGGG - Intronic
953966307 3:47309745-47309767 CCCGGCACCTCGGGAGGCCGAGG + Intronic
954059172 3:48055454-48055476 CCCGGCACCTCGGGAGGCCGAGG - Intronic
954162614 3:48733757-48733779 CCCGGCACCTCGGGAGGCCGAGG - Intronic
954210381 3:49093829-49093851 CCCCACACAACGGCGGGCGGGGG - Intronic
954356390 3:50085593-50085615 CCCGGCACCTCGGGAGGCCGAGG + Intronic
954567183 3:51608572-51608594 CCCGGCACCTCGGGAGGCTGAGG + Intronic
954599665 3:51858242-51858264 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
955228459 3:57079361-57079383 CCGGGGACCCCCGCGGGCGCCGG + Intergenic
955395035 3:58550877-58550899 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
955626733 3:60927249-60927271 CCCGGCACCTCGGGAGGCCGAGG - Intronic
955670179 3:61394132-61394154 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
955674681 3:61435474-61435496 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
955699926 3:61672465-61672487 CCCGGCACCTCGGGAGGCCGAGG + Intronic
956229631 3:66998721-66998743 CCCGGCACCCGTGCTCGCGGAGG - Intronic
956803740 3:72787964-72787986 CCCGGCACCTCGGGAGGCTGAGG - Intronic
957035331 3:75288959-75288981 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
957316921 3:78584065-78584087 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
958809043 3:98838792-98838814 CCCGGCACCTCGGGAGGCTGAGG + Intronic
958957615 3:100478721-100478743 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
959415879 3:106075534-106075556 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
960030234 3:113047288-113047310 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
960577388 3:119242215-119242237 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
960697948 3:120414031-120414053 CCCGGCACCTCGGGAGGCCGAGG - Intronic
960780754 3:121314339-121314361 CCCGGCACCTCGGGAGGCCGAGG + Intronic
960817434 3:121688436-121688458 CCCGGCACCTCGGGAGGCCGAGG - Intronic
960924546 3:122781300-122781322 CCCGGCACCTCGGGAGGCCGAGG + Intronic
961120887 3:124368807-124368829 CCCGGCACCTCGGGAGGCCGAGG + Intronic
961704299 3:128772840-128772862 CCTGGCACCTCGGGGGGCCGAGG - Intronic
961729082 3:128953855-128953877 CCCGGCACCTCGGGAGGCCGAGG - Intronic
961789243 3:129364084-129364106 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
961846760 3:129771522-129771544 CCCAGCACCCTGGGAGGCGGAGG + Intronic
961962290 3:130867540-130867562 CCCGGCACCTCGGGAGGCCGAGG - Intronic
962063070 3:131951813-131951835 CCCGGCACCTCGGGAGGCCGAGG - Intronic
962113192 3:132471991-132472013 CCCGGCACCTCGGGAGGCTGAGG + Intronic
962572051 3:136722942-136722964 CCCGGCACCTCGGGAGGCCGAGG - Intronic
962623182 3:137199025-137199047 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
962761708 3:138521058-138521080 CCCGGCACCTCGGGAGGCCGAGG - Intronic
963249211 3:143087333-143087355 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
963498259 3:146096137-146096159 CCCGGCACCTCGGGAGGCCGAGG - Intronic
963733171 3:148991819-148991841 CCCTGCACTCTGGGGGGCGGCGG - Intronic
963904578 3:150763082-150763104 CCCGGGACGCCGCCGGGAGGAGG - Exonic
963911738 3:150821581-150821603 CCCGGCACCCCGGGAGGCCGAGG + Intergenic
963991530 3:151661733-151661755 CCCAGCACCCTGGGAGGCGGAGG - Intergenic
964426091 3:156555187-156555209 CCCGTCAGCGCGGCGCGCGGAGG + Intergenic
966253575 3:177892324-177892346 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
966350887 3:179032252-179032274 CCCGGCACCTCGGGAGGCCGAGG - Intronic
966375489 3:179291453-179291475 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
966420324 3:179728727-179728749 CCCGGCACCTCGGGAGGCCGAGG + Intronic
966783724 3:183607589-183607611 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
966967044 3:185004225-185004247 CCCGGCACCCCGGGAGGCCGAGG + Intronic
967175972 3:186863791-186863813 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
967524147 3:190472952-190472974 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
967981759 3:195070037-195070059 CCCGGCAGCCCCTCGGGGGGCGG + Exonic
968042536 3:195600210-195600232 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
968124645 3:196149575-196149597 CCCAGCACTTCGGGGGGCGGAGG + Intergenic
968139333 3:196243784-196243806 CCCGGCACCTCGGGAGGCCGAGG - Intronic
968156441 3:196385252-196385274 CCCGGCACCTCGGGAGGCCGAGG - Intronic
968201953 3:196762442-196762464 CCCGGCACCTCGGGAGGCCGAGG + Intronic
968226121 3:196973448-196973470 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
968299661 3:197602938-197602960 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
968411533 4:395240-395262 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
968429980 4:551157-551179 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
968507035 4:975594-975616 CCCGGCACCTCGGGAGGCCGAGG - Intronic
968516928 4:1019394-1019416 CCAGGCACCCCTGCAGGCTGTGG + Intronic
968852925 4:3095272-3095294 CCCGGCACCTCGGGAGGCCGAGG + Intronic
968878348 4:3285975-3285997 CCCGGCACACCGGCAGGAAGTGG - Intergenic
968924424 4:3539454-3539476 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
969404050 4:6977371-6977393 CCCGGCACCTCGGGAGGCCGAGG - Intronic
970409114 4:15790426-15790448 CCCGGCACCTCGGGAGGCCGAGG - Intronic
971282173 4:25249965-25249987 CCCGGCACCTCGGGAGGCCGAGG + Intronic
971457923 4:26861274-26861296 CCCGGCACCTCCGCGGGCGGCGG + Exonic
972288160 4:37668466-37668488 CCCGGCACCTCGGGAGGCCGAGG - Intronic
972551900 4:40141833-40141855 CCCGGCACCTCGGGAGGCCGAGG + Intronic
972552759 4:40148196-40148218 CCCGGCACCTCGGGAGGCCGAGG + Intronic
972939623 4:44181496-44181518 CCCGGCGCCTCGGGGGGCCGAGG - Intronic
973263252 4:48186107-48186129 CCCGGCACCTCGGGAGGCCGAGG - Intronic
973281635 4:48364621-48364643 CCCGGCACCTCGGGAGGCCGAGG + Intronic
973593295 4:52464354-52464376 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
973664006 4:53139119-53139141 CCCGGCACCTCGGGAGGCCGAGG - Intronic
973675344 4:53256622-53256644 CCCGGCACCTCGGGAGGCCGAGG + Intronic
973752219 4:54032516-54032538 CCCGGCACCTCGGGAGGCCGAGG - Intronic
973785184 4:54326261-54326283 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
974082062 4:57224051-57224073 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
975042341 4:69761609-69761631 CCCGGCACCTCGGGAGGCCGAGG - Intronic
975063708 4:70037203-70037225 CCCGGCACCACGGGAGGCCGAGG - Intergenic
975685458 4:76916302-76916324 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
975908669 4:79244876-79244898 CCCGGCACCTCGGGAGGCCGAGG - Intronic
976266118 4:83186751-83186773 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
976607295 4:86995562-86995584 CCCGGCACCTCGGGAGGCCGAGG - Intronic
976765291 4:88592450-88592472 CCCCGCAAGCCTGCGGGCGGCGG - Exonic
977204999 4:94157524-94157546 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
978409008 4:108409073-108409095 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
978463935 4:108987488-108987510 CCCGGCTACCCGGCAGGCTGAGG - Intronic
978619354 4:110623038-110623060 CCAGGCACCCAGGCGAGCGACGG + Exonic
978820381 4:112958339-112958361 CCCGGCACCTCGGGAGGCCGAGG + Intronic
978947412 4:114516152-114516174 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
979225432 4:118278973-118278995 CCCTGAACCCCGGCGTGCGTGGG + Intergenic
979278195 4:118836199-118836221 CCCCGCCCCGCGGCGGCCGGTGG - Intronic
979482770 4:121238230-121238252 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
979702408 4:123684567-123684589 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
980895036 4:138853719-138853741 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
981782911 4:148445658-148445680 CCCGGCAGGCGGGCGGCCGGCGG + Intergenic
981970296 4:150658967-150658989 CCCGGCACCTCGGGAGGCCGAGG - Intronic
982053752 4:151527269-151527291 CCCGGCACCTCGGGAGGCCGAGG + Intronic
982192181 4:152867241-152867263 CCCGGCACCTCGGGAGGCTGAGG + Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983218266 4:165020693-165020715 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
983604438 4:169569742-169569764 CCCGGCACCTCGGGAGGCCGAGG - Intronic
983628656 4:169828053-169828075 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
983652116 4:170046004-170046026 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
983664571 4:170166826-170166848 CCTGGCACCTCGGGAGGCGGAGG + Intergenic
984005073 4:174295733-174295755 CCCGGCACCTCGGGAGGCCGAGG + Intronic
984037763 4:174691642-174691664 CCCGGCACCTCGGGAGGCCGAGG - Intronic
984728256 4:183041395-183041417 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
984804361 4:183737534-183737556 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
984813831 4:183819290-183819312 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
985216279 4:187657743-187657765 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
985247339 4:187991691-187991713 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
985894197 5:2739364-2739386 CCCAGCGCCCAGGCGGGCAGTGG - Intergenic
988544210 5:32141852-32141874 CCCGGCACCTCGGGAGGCCGAGG - Intronic
988760801 5:34307455-34307477 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
989061712 5:37416256-37416278 CCCGGCACCTCGGGAGGCCGAGG + Intronic
989068278 5:37484300-37484322 CCCGGCACCTCGGGAGGCTGAGG + Intronic
989076131 5:37564271-37564293 CCCGGCACCTCGGGAGGCCGAGG + Intronic
989574921 5:42980083-42980105 CCCGGCACCGCGGGAGGCCGAGG - Intergenic
989588126 5:43088863-43088885 CCCGGCACCTCGGGAGGCCGAGG + Intronic
989633367 5:43510691-43510713 CCCGGCACCTCGGGAGGCCGAGG - Intronic
989634735 5:43521751-43521773 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
989640581 5:43578894-43578916 CCCGGCACCCCGGGAGGCCGAGG + Intergenic
989812597 5:45695957-45695979 CTGGGCACCCCGCCGGGGGGCGG - Exonic
990382997 5:55233762-55233784 CCCCTCCCCCCGGCGGGCCGCGG - Intergenic
990462141 5:56039341-56039363 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
990501208 5:56398401-56398423 CCCGGCACCTCGGAAGGCCGAGG + Intergenic
991127486 5:63084372-63084394 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
991373119 5:65939797-65939819 CCCGGCACCTCGGGAGGCCGAGG - Intronic
991375206 5:65958366-65958388 CCCGGCACCTCGGGAGGCGGAGG + Intronic
991598012 5:68324299-68324321 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
991672718 5:69063441-69063463 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
991907436 5:71526184-71526206 CCCGGCACCTCGGGAGGCCGAGG + Intronic
992289490 5:75269790-75269812 CCCGGCACCTCGGAAGGCCGAGG - Intergenic
992415928 5:76551600-76551622 CCCGGCACCTCGGGAGGCCGAGG + Intronic
992463922 5:76985639-76985661 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
992690590 5:79236891-79236913 CCCGGCAGCCCGGCGGGCAGGGG + Exonic
992801634 5:80300821-80300843 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
992964325 5:81984172-81984194 CCCGGCACCTCGGGAGGCCGAGG + Intronic
992977885 5:82139092-82139114 CCCGGCACCTCGGGAGGCCGAGG - Intronic
993934572 5:93985673-93985695 CCCGGCACCTCGGGAGGCCGAGG - Intronic
995123735 5:108559875-108559897 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
995161970 5:108993284-108993306 CCCGGCACCTCGGGAGGCCGAGG + Intronic
995456743 5:112360523-112360545 CCCGGCACCTCGGGAGGCCGAGG - Intronic
995515847 5:112954460-112954482 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
995650148 5:114361263-114361285 CTCGGCACCCCGGCCGGGGGTGG - Intronic
995942478 5:117600529-117600551 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
995994368 5:118282272-118282294 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
996057610 5:118998741-118998763 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
996159782 5:120147672-120147694 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
997321756 5:132983676-132983698 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
997565420 5:134882585-134882607 CCCGGCACCTCGGGAGGCCGAGG + Intronic
997875091 5:137538824-137538846 CCCGGCACCTCGGAAGGCCGAGG + Intronic
998059959 5:139112095-139112117 CCCGGCACCTCGGGAGGCCGAGG - Intronic
998128159 5:139637936-139637958 CCCAGCACACCGGCCGGCTGGGG - Intergenic
998134672 5:139668416-139668438 CCTGGGACCCGGGCGGGCGCCGG - Intronic
998239606 5:140428381-140428403 CCCGGCACCTCGGGAGGCCGAGG + Intronic
998432324 5:142077088-142077110 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
999181250 5:149671141-149671163 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
999455766 5:151714591-151714613 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
999604302 5:153297527-153297549 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
999978945 5:156940206-156940228 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1000103557 5:158037741-158037763 CCCGGCACCTCGGGAGGCAGAGG + Intergenic
1000330156 5:160199540-160199562 CCCGGCTCCCCGTCGGCCTGGGG + Intronic
1000345852 5:160312634-160312656 CCCCGCGCCCCGCGGGGCGGGGG + Intronic
1000780352 5:165472767-165472789 CCCGGCACCCTGGGAGGCTGAGG - Intergenic
1000903657 5:166937092-166937114 CCCAGCACTCTGGGGGGCGGAGG - Intergenic
1001078031 5:168644178-168644200 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1002013517 5:176304437-176304459 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1002031428 5:176433372-176433394 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1002115634 5:176960881-176960903 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1002522115 5:179797846-179797868 CTCCGCGGCCCGGCGGGCGGGGG + Exonic
1002529503 5:179835431-179835453 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1002626282 5:180531730-180531752 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1002658358 5:180771554-180771576 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1003319584 6:5038631-5038653 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1003407558 6:5836393-5836415 CCCGGCACCCCGGGAGGCCGAGG + Intergenic
1004152368 6:13133545-13133567 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1004415113 6:15416433-15416455 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1004664378 6:17736223-17736245 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1004874228 6:19938950-19938972 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1005063717 6:21798116-21798138 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1005158626 6:22835984-22836006 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1005292134 6:24390090-24390112 CCCGGCACTCTGGGGGGCTGAGG + Intergenic
1005414596 6:25586700-25586722 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1005624775 6:27653152-27653174 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1005644839 6:27828221-27828243 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1005837076 6:29718148-29718170 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1005913025 6:30327115-30327137 CCCGGGCCCGAGGCGGGCGGAGG - Intronic
1005933282 6:30499228-30499250 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1005957115 6:30671931-30671953 CCCAGCACCCCGGGAGGCTGAGG - Intronic
1006004899 6:30993846-30993868 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1006128649 6:31855112-31855134 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1006210038 6:32385838-32385860 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1006225250 6:32531793-32531815 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1006232552 6:32596543-32596565 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1006282012 6:33060498-33060520 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1006346433 6:33486308-33486330 CCCGGCACCTCGGGGGGCCGAGG + Intergenic
1006546532 6:34786075-34786097 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1006617441 6:35339985-35340007 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1006826737 6:36941271-36941293 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1006922747 6:37637273-37637295 CTGGGCACCCCAGCTGGCGGGGG + Exonic
1008112329 6:47506547-47506569 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1008184455 6:48371806-48371828 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1008480572 6:51981567-51981589 CCCGGCACCCCGGGAGGCCGAGG - Intronic
1008841730 6:55910731-55910753 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1008926741 6:56895762-56895784 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1008965812 6:57311774-57311796 CCCAGCACCTCGGGAGGCGGAGG + Intergenic
1009392666 6:63163599-63163621 CCCAGCACCCCGGGAGGCTGAGG - Intergenic
1009622785 6:66097329-66097351 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1010030605 6:71267140-71267162 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1010192172 6:73206105-73206127 CCCGGCACCTTGGGAGGCGGAGG + Intergenic
1010264540 6:73851698-73851720 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1010400723 6:75442499-75442521 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1010513029 6:76743904-76743926 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1011148772 6:84245359-84245381 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1011398774 6:86937617-86937639 CGCCGCACCCCGGCGGGCACTGG + Exonic
1011474326 6:87736566-87736588 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1011476233 6:87751829-87751851 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1011587958 6:88946894-88946916 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1011734272 6:90296429-90296451 CCCGCCACCCCGCCCAGCGGCGG + Intronic
1012899712 6:104991758-104991780 CCCGGCACCCCAGGAGGCCGAGG + Intronic
1012983820 6:105854642-105854664 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1013190794 6:107802994-107803016 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1013204440 6:107933971-107933993 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1013243780 6:108269465-108269487 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1013459131 6:110358359-110358381 GCCCGCACCCCGGCCCGCGGGGG - Intergenic
1013637987 6:112047359-112047381 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1013681435 6:112528912-112528934 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1014123313 6:117750639-117750661 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1014463756 6:121730147-121730169 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1014557262 6:122850053-122850075 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1015071699 6:129102210-129102232 CCCGGGAACCCGGGAGGCGGAGG - Intronic
1015643811 6:135364637-135364659 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1016476575 6:144434088-144434110 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1016590165 6:145735350-145735372 GCCGGCACCGCGGCGGGCGACGG - Exonic
1016597204 6:145815334-145815356 CCCTGGATCCCGGCGGGCGGCGG + Intergenic
1016937264 6:149456626-149456648 CCTGACACCCTGGGGGGCGGCGG - Intronic
1016959831 6:149662709-149662731 CCCAGCACCCTGGGAGGCGGAGG + Intronic
1017170279 6:151449899-151449921 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1017465047 6:154686926-154686948 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1017493967 6:154967128-154967150 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1017660541 6:156669886-156669908 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1017851650 6:158309636-158309658 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1017914205 6:158819163-158819185 CCCGGCACCCCCGGGGCAGGTGG - Intronic
1018295196 6:162338502-162338524 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1018528261 6:164736748-164736770 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1019438972 7:1037495-1037517 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1019459259 7:1147707-1147729 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1019569761 7:1705453-1705475 CCTGGCACCCTGGCGGTTGGGGG - Intronic
1019651427 7:2161355-2161377 CCCGGCACCGCGGGAGGCCGAGG - Intronic
1019668888 7:2267562-2267584 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1019674312 7:2302352-2302374 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1019711482 7:2520017-2520039 CCCGGCGCCCGGGCTGGGGGCGG + Exonic
1019725440 7:2599735-2599757 CCCAGCACTCCGGGAGGCGGAGG - Intronic
1020109357 7:5439581-5439603 CCCGGCAGCCAGGCGGGGGCGGG - Intronic
1020157170 7:5736370-5736392 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1020288839 7:6706813-6706835 GCCGGCACCCAAGCGGGCGCGGG - Exonic
1020498770 7:8890209-8890231 CCTGGCACCTCGGGAGGCGGAGG - Intergenic
1020831589 7:13102204-13102226 CCGGGCACCTCGGGAGGCGGAGG - Intergenic
1021120532 7:16790782-16790804 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1021440106 7:20667973-20667995 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1022005275 7:26261515-26261537 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1022083158 7:27044331-27044353 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
1022273984 7:28838442-28838464 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1022317968 7:29263278-29263300 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1022923411 7:35037656-35037678 CGCGGAACGCCGGGGGGCGGGGG + Intronic
1023160460 7:37292198-37292220 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1024305025 7:47922162-47922184 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1024309721 7:47959072-47959094 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1024538573 7:50459207-50459229 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1024625700 7:51207680-51207702 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1024989330 7:55220935-55220957 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1025000459 7:55311466-55311488 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1025011752 7:55403188-55403210 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1025032996 7:55572430-55572452 CCGGGCCCCCCAGCGGTCGGCGG - Exonic
1025730004 7:64100484-64100506 CCCGGAAGCCCGGCGGTGGGAGG + Intronic
1025775046 7:64553835-64553857 CCCGGCACCTCGGGAGGCCGTGG - Intronic
1025778220 7:64577123-64577145 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1025793546 7:64717574-64717596 CCCGGCACCTCGGGGGGCCGAGG - Intergenic
1025796142 7:64739311-64739333 CCCGGCACCCTGGGAGGCCGAGG + Intergenic
1025852712 7:65257644-65257666 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1025979644 7:66394817-66394839 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1026007911 7:66614319-66614341 CCCGGCACCTCGGGGGGCCGAGG - Intergenic
1026765269 7:73155760-73155782 CCCGTCGCCACGGCGGGGGGAGG + Intergenic
1026783571 7:73285069-73285091 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1026862205 7:73797827-73797849 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1027041743 7:74965516-74965538 CCCGTCGCCACGGCGGGGGGAGG + Intronic
1027081899 7:75236853-75236875 CCCGTCGCCACGGCGGGGGGAGG - Intergenic
1027183071 7:75953064-75953086 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1027374111 7:77534605-77534627 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1028227578 7:88267139-88267161 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1028685744 7:93586831-93586853 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1028762262 7:94509695-94509717 TCACGCGCCCCGGCGGGCGGCGG - Intronic
1029279327 7:99426440-99426462 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1029430254 7:100524311-100524333 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1029469094 7:100742612-100742634 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1029495678 7:100894699-100894721 CCCGGGGCCCTGGGGGGCGGTGG + Intronic
1029963213 7:104710068-104710090 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1030036441 7:105411490-105411512 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1030288187 7:107847803-107847825 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1030692579 7:112551266-112551288 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1030725584 7:112922206-112922228 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1032056552 7:128689051-128689073 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1032290967 7:130590506-130590528 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1032569424 7:132984313-132984335 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1032589272 7:133177227-133177249 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1033173065 7:139101093-139101115 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1033219865 7:139520793-139520815 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1033323639 7:140361800-140361822 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1033332998 7:140431229-140431251 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1033565583 7:142575174-142575196 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1034638976 7:152586978-152587000 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1034723668 7:153315904-153315926 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1036095874 8:5724969-5724991 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1036785250 8:11681273-11681295 CCCGGAACCTCAGCGTGCGGAGG - Intronic
1036830269 8:12015162-12015184 CTGGGCATCCCGGCGGGCGCGGG + Intronic
1037529112 8:19756993-19757015 CCTGGGCCCCCGGCGGGCAGCGG + Intronic
1037627968 8:20624720-20624742 CCCGGCACTTCGGCGGACTGAGG + Intergenic
1037940342 8:22946422-22946444 CCTGGCAACCCGGGAGGCGGAGG + Intronic
1038594989 8:28880509-28880531 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1038745001 8:30247628-30247650 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1039072392 8:33658968-33658990 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1039488084 8:37927371-37927393 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1039881313 8:41627011-41627033 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1039907636 8:41798197-41798219 CCAGCCTCCCCGGGGGGCGGAGG - Intronic
1040041455 8:42919688-42919710 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1040043634 8:42940227-42940249 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1040052974 8:43033720-43033742 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1040070135 8:43180838-43180860 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1040121452 8:43688385-43688407 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1040425482 8:47280786-47280808 CCCGGCACTCTGGGAGGCGGAGG - Intronic
1040785374 8:51158701-51158723 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1040818525 8:51533735-51533757 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1041287116 8:56272728-56272750 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1041363049 8:57072026-57072048 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1041513702 8:58676994-58677016 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1041796782 8:61753827-61753849 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1042133893 8:65616383-65616405 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1042139212 8:65662348-65662370 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1042195945 8:66231913-66231935 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1042290859 8:67168042-67168064 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1042912722 8:73844397-73844419 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1043961723 8:86424550-86424572 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1044507501 8:93038862-93038884 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1044692486 8:94894775-94894797 CCCGGCGCCCCTCCGAGCGGCGG - Intronic
1044969323 8:97604604-97604626 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1045063529 8:98427190-98427212 CCCGGCGGGCCGGCGGGCGGGGG - Exonic
1045098961 8:98825925-98825947 CCGGGCACCGCGGCGGGGGGCGG + Intronic
1045195539 8:99926870-99926892 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1045277784 8:100722472-100722494 CCCGTCACCGCGGCGGTGGGCGG + Exonic
1046636147 8:116678243-116678265 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1047274587 8:123396116-123396138 GCCGGCAGCCCGGCGCTCGGAGG - Intronic
1048368257 8:133757157-133757179 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1049177538 8:141202895-141202917 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1049447083 8:142636142-142636164 CCTGGCACCCCGCAGGCCGGAGG + Intergenic
1049481731 8:142827554-142827576 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1049747620 8:144269725-144269747 CCTGGCTTCCCGGCGGGCGGAGG - Intronic
1049976117 9:862247-862269 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1049998440 9:1051923-1051945 CGCTGCACTCCCGCGGGCGGCGG + Exonic
1050534802 9:6622492-6622514 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1050558049 9:6807138-6807160 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1050571988 9:6949586-6949608 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1051020717 9:12539320-12539342 CCCTGCAGCCTGCCGGGCGGAGG - Intergenic
1051257939 9:15233606-15233628 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1051281168 9:15442916-15442938 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1051430758 9:16978076-16978098 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1052236322 9:26215643-26215665 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1052258978 9:26492206-26492228 CCCAGCACCCCGGGAGGCCGAGG - Intergenic
1052338521 9:27342716-27342738 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1052492962 9:29189757-29189779 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1052941790 9:34137089-34137111 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1053082030 9:35184455-35184477 CCCAGCACCCCGGGAGGCCGAGG + Intronic
1054906693 9:70419386-70419408 CCCTGCACCCGGGAGCGCGGGGG + Intergenic
1055134060 9:72807009-72807031 CCCGGCACCTCGGGAGGCTGAGG + Intronic
1055241967 9:74197095-74197117 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1055297888 9:74852741-74852763 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1055321730 9:75088758-75088780 GCCGGCACCGCGGCGGTCGCAGG - Intronic
1055506555 9:76955114-76955136 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1055519006 9:77061348-77061370 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1055580675 9:77703569-77703591 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1055948147 9:81709790-81709812 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1056152376 9:83803503-83803525 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1056564534 9:87759645-87759667 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1056670747 9:88625732-88625754 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1056992302 9:91423604-91423626 GCCGGGCCCCCGGCCGGCGGTGG + Intronic
1057155228 9:92832204-92832226 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1057619028 9:96619134-96619156 CCGGGCAGCCCGGTGGGAGGTGG + Intronic
1057716299 9:97498638-97498660 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1057751370 9:97796095-97796117 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1058018725 9:100067441-100067463 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1058375369 9:104316310-104316332 CCCGGCACCCCGGCAGGCCGAGG - Intergenic
1058660079 9:107258253-107258275 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1058722390 9:107775606-107775628 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1059118234 9:111617967-111617989 CCCGGCACCTCGGGGGGCTGAGG + Intergenic
1059120655 9:111640176-111640198 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1059707908 9:116841122-116841144 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1059880061 9:118678793-118678815 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1060041408 9:120304589-120304611 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1060349968 9:122851747-122851769 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1060686926 9:125623046-125623068 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1061635703 9:131907468-131907490 CCCGGCACCTCGGTAGGCGGAGG - Intronic
1062162488 9:135087896-135087918 GCGGGCACCGCGGCGGGCAGGGG - Exonic
1062306173 9:135908008-135908030 CCCGGCCCCCTGGCCGGCCGAGG + Intergenic
1062352484 9:136145859-136145881 CCCGGCACCCTGGGGGCTGGTGG + Intergenic
1062448332 9:136604998-136605020 GCAGGCCCCCAGGCGGGCGGTGG - Intergenic
1062507543 9:136885967-136885989 CCCGGCACCGGGGGAGGCGGAGG + Intronic
1062565712 9:137163089-137163111 CCGGGCACCCCGGAGGGCGCGGG + Intronic
1203464144 Un_GL000220v1:69100-69122 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1203471347 Un_GL000220v1:116556-116578 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1203471380 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203472038 Un_GL000220v1:119212-119234 CCCAGCTCCACGGCGGGCCGAGG - Intergenic
1203479168 Un_GL000220v1:160528-160550 CCGGGCACCCGGGGGGCCGGCGG + Intergenic
1203479201 Un_GL000220v1:160624-160646 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1185544908 X:935692-935714 CCCGGCACTCTGGGGGGCCGAGG + Intergenic
1186486052 X:9935220-9935242 CCCGGGAGCCGGGGGGGCGGGGG + Intronic
1186786768 X:12962892-12962914 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1187183823 X:16965855-16965877 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1187184441 X:16969471-16969493 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1187212657 X:17245549-17245571 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1188086302 X:25905506-25905528 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1188368100 X:29335021-29335043 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1188492818 X:30754515-30754537 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1189505744 X:41611949-41611971 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1189570152 X:42286363-42286385 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1189785923 X:44558797-44558819 CCCAGCACCCTGGGAGGCGGAGG - Intergenic
1189838193 X:45041997-45042019 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1189955681 X:46274959-46274981 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1190114773 X:47619505-47619527 CCCGGGTCCTCGGGGGGCGGTGG - Exonic
1190158933 X:48016554-48016576 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1190171387 X:48114892-48114914 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1190174630 X:48138819-48138841 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1190184417 X:48222039-48222061 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1190241510 X:48660313-48660335 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1190326221 X:49208643-49208665 CCCGGAGCCCCGGCGAGCTGAGG + Exonic
1190841868 X:54152943-54152965 CCCGGCACTCTGGGAGGCGGAGG + Intronic
1190848428 X:54215439-54215461 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1190891639 X:54573291-54573313 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1191069119 X:56380911-56380933 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1191637239 X:63392685-63392707 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1191828583 X:65392015-65392037 CCCGGCACCTCGGGAGGCTGAGG - Intronic
1192106870 X:68326116-68326138 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1192252022 X:69421645-69421667 CCCGGCACCTCGGGAGGCTGAGG - Intergenic
1192260805 X:69505004-69505026 CCCGGCGTCCCGGCTGGGGGCGG - Intergenic
1192324716 X:70122693-70122715 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1192353020 X:70372388-70372410 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1192464204 X:71342275-71342297 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1192500263 X:71645614-71645636 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1192567576 X:72178194-72178216 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
1192610133 X:72559320-72559342 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1192768398 X:74165961-74165983 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1192813632 X:74569561-74569583 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1192970022 X:76218966-76218988 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1193067947 X:77278951-77278973 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1193114975 X:77766965-77766987 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1193132540 X:77932650-77932672 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1193328875 X:80214750-80214772 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1193345386 X:80397674-80397696 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1193372230 X:80712399-80712421 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1193890102 X:87033719-87033741 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1194181089 X:90713359-90713381 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1194714803 X:97276022-97276044 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1195364264 X:104112393-104112415 GCCGGCGGGCCGGCGGGCGGGGG - Intronic
1196778422 X:119361646-119361668 CCCGGCACCCCGGGAGGCCGAGG - Intergenic
1197199184 X:123733777-123733799 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1197452821 X:126641004-126641026 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1198108756 X:133484397-133484419 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1198189240 X:134286456-134286478 CCCGGCACCTCGGGAGGCTGAGG + Intergenic
1198246736 X:134838944-134838966 CCCGGCACCTCGGGAGGCCGAGG - Intronic
1198260314 X:134959989-134960011 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1198476692 X:137001413-137001435 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1199586315 X:149420378-149420400 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1200135593 X:153873130-153873152 CCCGGCACTCAGGAGGGCGGGGG + Intronic
1200323722 X:155216427-155216449 CACGGAATCCCGGCGGCCGGCGG + Exonic
1200324697 X:155224347-155224369 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1200384318 X:155874621-155874643 CCCGGGACTCCGGAGAGCGGCGG - Intergenic
1200387535 X:155908304-155908326 CCCGGCACCTCGGGAGGCCGAGG + Intronic
1200527707 Y:4295248-4295270 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1200953024 Y:8918642-8918664 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1201335681 Y:12878383-12878405 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1201440349 Y:14001308-14001330 CCCGGCACCTCGGGAGGCCGAGG + Intergenic
1201444222 Y:14041400-14041422 CCCGGCACCTCGGGAGGCCGAGG - Intergenic
1201948209 Y:19535449-19535471 CCCGGCACCTCCGGAGGCGGAGG - Intergenic